Count method

Counting elements within a sequence

Sometimes we have a sequence—string, list, or tuple—and we’d like to know how many times a particular element occurs in the sequence. Python supplies a .count() method for each of these types. This method takes an argument and returns the number of times the value of the argument appears in the underlying sequence.

Examples:

s = "How many 'a's are in this string which includes " \
    "the phrase 'I'm bananas about bananas'?"
n = s.count('a')
print(n)   # prints 11

# Now let's check for the letter 'z'
n = s.count('z')
print(n)   # prints 0, because there are no 'z's in s

You can count non-overlapping substrings in a string as well.

dna_fragment = "GACTGTAGACTTAGGGCTTAGAGTACTAGTAGCTGACTGACACG"
n = dna_fragment.count("GTA")
print(n)   # prints 3 (check for yourself)

Another example:

"""Source of quote: The Metamorphosis by Franz Kafka,
translated by David Wyllie, via Project Gutenberg:
https://www.gutenberg.org/cache/epub/5200/pg5200.txt"""

metamorphosis = ("One morning, when Gregor Samsa woke from "
                "troubled dreams, he found himself transformed "
                "in his bed into a horrible vermin. He lay "
                "on his armour-like back, and if he lifted "
                "his head a little he could see his brown "
                "belly, slightly domed and divided by arches "
                "into stiff sections. The bedding was "
                "hardly able to cover it and seemed ready "
                "to slide off any moment. His many legs, "
                "pitifully thin compared with the size of "
                "the rest of him, waved about helplessly as "
                "he looked.")
n = metamorphosis.count("Gregor")
print(n)     # prints 1
n = metamorphosis.count("bed")
print(n)     # prints 2
n = metamorphosis.count("he")
print(n)     # prints 11
# Doesn't count "He" (case-sensitive) but does count "he"
# in "when", "head", "arches", "the", and "helplessly".

It works with lists too.

lst = [9, 0, 3, 1, 3, 2, 5, 8, 9, 7, 1, 0, 2, 2, 4, 0, 5, 1]
n = lst.count(1)
print(n)   # prints 3
n = lst.count(9)
print(n)   # prints 2
n = lst.count(8)
print(n)   # prints 1
n = lst.count(6)
print(n)   # prints 0

It works with tuples also.

t = ('Bob', 'Charlene', 'Bob', 'Alice', 'Alice', 'Dolores')
n = t.count('Bob')
print(n)    # prints 2
n = t.count('Charlene')
print(n)    # prints 1
n = t.count("Egbert")
print(n)    # print 0

Keep in mind what counts as an element in a sequence.

t = (('a', 97), ('b', 98), ('c', 99), ('d', 100), ('e', 101))

n = t.count(('c', 99))
print(n)    # prints 1
n = t.count('c')
print(n)    # prints 0
n = t.count(99)
print(n)    # prints 0

The last two calls to .count() return zero because neither 'c' nor 99 are elements of t. The elements of t are tuples, e.g., ('c', 99).

Comprehension check

1. Given the string: s = "amanaplanacanalpanama", what is the evaluation of s.count('a')?

2. Given the same string, what is the evaluation of count('ma')?

3. Does this work? count(s, 'p')? Why or why not?

4. Given this tuple, t = ('cheddar', 'gouda', 'munster'), what is the evaluation of t[0].count('d')?

Copyright © 2023–2025 Clayton Cafiero

No generative AI was used in producing this material. This was written the old-fashioned way.