REGULATION OF NUTRIENT USE IN FOOD PRODUCING ANIMALS

Investigators: Knapp, J.

Performing Department: Animal Science -- 0331

Start Date: 10/01/1997 Termination Date: 09/30/2002
Reporting period: 10/01/1997 to 09/30/2002
Report was submitted to CRIS on 04/08/2003

Termination Report:
This project has not been completed. Rather it has been transferred from multi-state project NE-148 to NC-1009. We are in the process of collecting the clones of bovine genes to establish the mini-array technology. In parallel, we are developing real-time PCR analyses to independently confirm the gene expression determined by the mini-arrays.

Publications:
(No publications.)

Impact:
We expect that both the dot blot and microarray approaches when combined with the appropriate biochemical analyses will give us valuable information on nutrient utilization in specific biochemical pathways in support of lactation that will provide quantitative information for determining nutrient requirements in dairy cattle.

Hormonal control of growth and energy use by chickens deficient in amino acids.

Investigators: Carew, L. B.

Performing Department: Animal Science -- 0331

Start Date: 10/01/1999 Termination Date: 09/30/2003
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
Results accumulated with studies on several essential amino acids (EAA) were analyzed further. With an arginine (Arg) deficiency, chicks fed between 60-80% (0.75% and 1.0%) of the National Research Council recommended level of 1.25% Arg from 8-22 days of age showed no differences in plasma growth hormone (GH) when compared to results obtained with free-fed or pair-fed controls. Since we previously showed that plasma levels of insulin-like growth factor I (IGF-I) decrease in an Arg deficiency, these data suggest that circulating levels of GH are not regulators of IGF-I. Liver color was significantly paler or more yellow in Arg-deficient chicks than in any control group. This, coupled with our earlier observation of enlarged livers in Arg-deficient chicks, suggests that fatty infiltration of the liver occurred in the deficient chicks and should be studied further. With a phenylalanine (Phe) deficiency, plasma levels of GH were markedly elevated showing that Arg and Phe deficiencies of have differing effects on this hormone. Thyroid weights in Phe-deficient chicks were heavier but on histological examination follicles were smaller with a severe Phe deficiency. This was accompanied by elevations in plasma triiodothyronine as reported earlier. These studies continue to show that deficiencies of individual EAA have markedly different effects on the endocrine system. Thus, physiological and hormonal changes observed in protein deficient animals are not a consequence of EAA deficiencies in general but are most likely related to the specific pattern or profile of limiting EAA present in the diet.

Publications:
Carew, L.B., Alster, F.A. Vasilatos-Younken, R., McMurtry, J.P. and Zakrzewska, E.I. 2002. Changes in organ size and plasma levels of thyroid hormones, growth hormone and insulin-like growth factors in chicks fed diets deficient in arginine. Poultry Sci. 81 (Suppl. 1):68.

Carew, L.B., Valverde, M.T., Zakrzewska, E.I., Alster, F.A. and Gernat, A.G. 2002. Raw velvet beans (Mucuna pruriens) and L-dopa have differing effects on organ growth and blood chemistry when fed to chickens. In: Proceedings of the International Workshop, "Food and Feed From Mucuna: Current Uses and the Way Forward." Pp. 272-287. Eds. M. Flores B., M. Eilitta, R. Myhrman, L.B. Carew and R.J. Carsky. International Cover Crops Clearinghouse (CIDICCO), P.O. Box 4443, Tegucigalpa, Honduras.

Impact:
Our studies show that deficiencies of essential amino acids (EAA) exert some of their effects on growth and development through changes in the endocrine system. Nutritionists are increasingly formulating diets with minimal protein levels supplemented with pure amino acids to achieve a better EAA balance. This increases the possibility of single amino acid deficiencies. Through studies such as the current ones reported for arginine and phenylalanine deficits, we show that deficiencies of individual EAA have differing effects on the avian endocrine system. Understanding these relationships will help in adequately balancing low-protein diets that are supplemented with individual amino acids. This should result in improved nutrient balance, reduced costs, and less environmental pollution through reduced nitrogen excretion.

Mastitis resistance to enhance dairy food safety.

Investigators: Kerr, D.

Performing Department: Animal Science -- 0331

Start Date: 10/01/1999 Termination Date: 09/30/2002
Reporting period: 10/01/1999 to 09/30/2002
Report was submitted to CRIS on 04/08/2003

Termination Report:
Staphylococcus aureus is a contagious pathogen that often results in chronic intramammary infections in dairy cows. Current vaccine formulations are ineffective in preventing this infection. The objective of this study was to stimulate an immune response in dairy cows through injection of plasmid DNA designed to express staphylococcal Protein A in transfected cells. Intramuscular and intradermal vaccination sites were evaluated using a plasmid containing the CMV promoter/enhancer directing expression of Green Fluorescent Protein (pcDNA3/GFP). DNA was delivered by needle and syringe, or by high, intermediate, or low pressure jet injections (Ped-o-jet and LECTRAJET). Five cows per treatment were injected with 0.5 mg of plasmid DNA at six, four, and two weeks prepartum. Serum antibody levels determined by ELISA indicated that intradermal high-pressure jet injection elicited a greater immune response compared to needle and syringe injection. Differences in antibody production among low pressure and needle and syringe treatment groups were not significant. An expression plasmid containing the CMV promoter/enhancer driving expression of the Fc binding domain of S. aureus Protein A was co-injected into cows by vulvamucosal vaccination using the high pressure Ped-o-jet. Beginning six weeks prepartum, groups of cows (n=5) were injected three times at two week intervals with DNA in saline, DNA in aluminum phosphate adjuvant, or served as non-injected controls. A cellular immune response to Protein A was detected in four of ten animals, while cellular responses to GFP were not detected. Humoral responses to Protein A were observed in six of ten animals, and to GFP in two of ten animals. Aluminum phosphate adjuvant appeared to enhance antibody production in response to Protein A. In experiment three, a protein boost injection of Protein A was given to six animals approximately five months postpartum. Three animals were non-vaccinated controls, and three were among those stimulated to produce antibody in response to the DNA-based vaccine. These results showed that Protein A specific antibodies remained elevated as compared to non-vaccinated controls and were stimulated in response to the protein boost. However, the magnitude of the response in animals previously vaccinated with DNA was not different than that observed in the non-vaccinated controls. We have shown that a humoral and cellular immune response to abbreviated Protein A can be raised in dairy cows using intravulvamucosal jet injection of a DNA-based vaccine.

Publications:
Fan, W., K. Plaut, A.J. Bramley, J.W. Barlow, and D.E. Kerr. 2002. Adenoviral-mediated transfer of a lysostaphin gene into the goat mammary gland. Journal of Dairy Science 85:1709-1716

Carter, E.W., and D.E. Kerr. 2003. Development of a DNA-based vaccination for the prevention of bovine staphylococcal mastitis. Journal of Dairy Science 86:(in press

Impact:
There is great potential for the production of DNA vaccines for the prevention of bovine mastitis. Significant hurdles to overcome include increasing the magnitude of the response and lowering the dose of DNA required to ensure economic feasibility.

Enhancing Bovine Mammary Development to Improve Milk Production Efficiency

Investigators: McFadden, T. B.

Performing Department: Animal Science -- 0331

Start Date: 10/01/2000 Termination Date: 09/30/2003
Reporting period: 02/15/2002 to 02/14/2003
Report was submitted to CRIS on 04/08/2003

Progress Report:
An experiment on hormonal induction of lactation in dairy heifers was completed and mammary biopsy samples were collected. Hormonal induction evoked a significant increase in proliferation of mammary cells. Heifers exposed to short day photoperiod during induction produced significantly more milk than those exposed to long days. In a second experiment, serial mammary biopsy samples were obtained from dry cows at several stages of gestation. Several cell culture experiments were completed and others are ongoing. Samples obtained from these trials are being analyzed, using low density cDNA arrays and real-time PCR, to determine changes in gene expression and relate them to indicators of mammary development and function. Based on preliminary results, studies are focusing on at least six genes that were differentially expressed. Five abstracts have been submitted.

Publications:
Neville, M.C., T.B. McFadden and I.A. Forsyth. 2002. Hormonal regulation of mammary differentiation and milk secretion. J. Mammary Gland Biol. Neoplasia 7:49-66.

McFadden, T.B. 2002. Proliferation-associated gene expression in bovine mammary gland. J. Dairy Sci. 85(Suppl. 1):3.

Auchtung, T.L., B.C. Pollard, P.E. Kendall, T.B. McFadden and G.E. Dahl. 2002. Prolactin receptor expression responds to photoperiod similarly in multiple tissues in dairy cattle. J. Anim. Sci. 80(Suppl. 1):9.

Impact:
This project is expected to identify some of the key genes that regulate mammary development in dairy cows and how they might be manipulated to enhance udder growth. If successful, this would be expected to increase the efficiency of milk production.

Regulation of Mammary Development and Lactation

Investigators: Plaut, K.

Performing Department: Animal Science -- 0331

Start Date: 10/01/2001 Termination Date: 09/30/2004
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
In the past year, we successfully manufactured implants containing transforming growth factor beta-1. We were able to surgically place the local implants into the mammary glands of (6)pre-pubertal heifers. Two animals were used to develop the techniques for implantation and the final four animals were the actual test animals. After a 24 hour period, we removed the mammary glands from the animals and processed the tissue for future analysis. We are in the process of looking at DNA synthesis by bromodeoxyuridine expression and gene expression in these tissues. We have completed the animal portion of this experiment and will be conducting the laboratory analyses on the tissues in the upcoming year.

Publications:
(No publications.)

Impact:
We believe that these experiments will help us to better understand mammary development during the pre-pubertal stage in heifers. It is well known that this developmental time frame is important to the future milk production in dairy cattle. These data will help us to understand the mechanisms involved in mammogenesis and lactation.

Glucose Transporter Gene Expression in Bovine Mammary Gland

Investigators: Zhao, F. Q.

Performing Department: Animal Science -- 0331

Start Date: 10/01/2001 Termination Date: 09/30/2002
Reporting period: 10/01/2001 to 09/30/2002
Report was submitted to CRIS on 04/08/2003

Termination Report:
This one year 'start-up' project was to support PI, a new faculty member, to initiate his research on glucose transport of lactating bovine tissues in supporting milk synthesis and maintaining glucose homeostasis. In this one year period, tissue samples of mammary gland, liver, lung, kidney, spleen, skeletal muscle, omental fat and intestine mucosa were collected at local USDA slaughter houses from three lactating dairy cows, shipped from the University of Vermont Farm. The tissue samples were collected immediately after the animals are euthanized, rapidly frozen in liquid nitrogen and stored at -80C. The total RNAs from these tissues were prepared using TRIzol reagents (Invitrogen) and the poly(A) RNAs were isolated from the total RNAs by oligodeoxythymidylate cellulose chromatography. The proposed strategy to clone bovine glucose transporter isoforms has been successfully applied to clone bovine SGLT1 (bSGLT1). Using the Clontech SMART RACE cDNA Amplification kit and poly(A) RNA from bovine kidney, the 5' RACE fragments of bovine SGLT1 were obtained with the primers 5'- GTAGGCGATGTTGGTACAGC -3' that were designed in highly conserved regions in human, mouse, rat, horse and sheep. Similarly, the 3' RACE fragments of bovine SGLT1 were obtained by using the primers 5'- CGCTGACCTCCATCTTCAAC -3'. Our previous study showed at least four different SGLT1 transcripts in bovine tissues (Zhao et al., 1999). The 3' RACE experiments in this study confirmed that these different sizes of transcripts are due to different lengths of the 3' untranslated region. The cDNA clones containing the complete coding sequence of bSGLT1 have been generated by RT-PCR using primers designed from our RACE fragments at the 5' (5'- CAGCTGCCACTATGGACAGTA -3') and 3' (5'- CCTTCTGCAGCTCAGATATG -3') untranslated regions of the cDNA. The sequence of the bSGLT1 has been verified in at least three independent clones and has been submitted to GenBank with access number AF508807. The 664 amino acid sequence of bSGLT1 shows 98% and 86% identity to sheep (GenBank # CAA57809) and human (GenBank #AAA60320) SGLT1, respectively. Meanwhile, our RACE experiments also provide sequence information for another SGLT1-related isoform (SGLTx). The partial sequence of bovine SGLTx 5' RACE fragment shows 85% identity to rabbit RKD (kidney clone D, GenBank #U08813).

Publications:
(No publications.)

Impact:
SGLT1 plays important role in glucose uptake in the small intestine and glucose reabsorption in kidney. It has also been shown to be expressed in the lactating bovine mammary gland. Obtaining the full bSGLT1 cDNA clone will help us to study the transport kinetics of bSGLT1 and to study its functional role in supporting milk synthesis in the mammary gland and in maintaining glucose homeostasis in gastrointestine and kidney.

A Transgenic Model to Study Prolactin Action in the Mammary Gland

Investigators: Hovey, R.

Performing Department: Animal Science -- 0331

Start Date: 05/01/2002 Termination Date: 09/30/2003
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
This project seeks to identify the effects of overexpressing the prolactin receptor in the mammary glands of transgenic mice. Current studies are determining whether protein expression of the transgene product can be determined. We are analyzing tissue extracts from mammary glands of several lines of mice by western blotting using an anti-fusion epitope antibody. While preliminary data indicates limited protein expression, further studies are underway to clarify this matter.

Publications:
(No publications.)

Impact:
Given the critical role for prolactin in development of the mammary gland and in milk production during lactation, we hypothesize that increased levels of its receptor expressed by mammary epithelial cells will result in increased mammary growth and milk production. Ultimately this will provide a mechanism for manipulating and enhancing milk production in dairy animals.

Genetic and functional genomic approaches to improve production and quality of pork

Investigators: Hovey, R. C.

Performing Department: Animal Science -- 0331

Start Date: 10/01/2002 Termination Date: 09/30/2005
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
Funding for this project recently commenced. Total RNA from pig mammary glands was analyzed by RT-PCR for the known portion of the porcine prolactin receptor (PRLR). A PCR product of the anticipated size was cloned and sequenced, and was found to correspond to the known porcine PRLR cDNA. We are currently performing rapid amplification of cDNA ends (RACE) to obtain full-length cDNA for the pPRLR.

Publications:
(No publications.)

Impact:
Identifying the genetic sequence of the porcine prolactin receptor will help in efforts to identify the action of prolactin in swine growth, health and reproduction

Interpreting cattle genomic data: biology, applications, and outreach

Investigators: Kerr, D. E.

Performing Department: Animal Science -- 0331

Start Date: 10/01/2002 Termination Date: 09/30/2005
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
We have developed bovine mammary cell culture system that will allow us to identify genes that are induced or repressed in these cells in response to infection with mastitis pathogens. We have now identified two genes that are induced by infection with Staphylococcus aureus.

Publications:
(No publications.)

Impact:
(Impact narrative has not been submitted.)

Regulation of glucose transport in lactating bovine tissues

Investigators: Zhao, F.

Performing Department: Animal Science -- 0331

Start Date: 10/01/2002 Termination Date: 09/30/2005
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
The project has been started as planned. The tissue samples of the mammary gland, liver, lung, kidney, spleen, skeletal muscle, omental fat and intestine mucosa were collected at local USDA slaughter houses from three lactating dairy cows, shipped from the University of Vermont Farm. The tissue samples were collected immediately after the animals are euthanized, rapidly frozen in liquid nitrogen and stored at -80C. The total RNAs from these tissues were prepared using TRIzol reagents (Invitrogen) and the poly(A) RNAs were isolated from the total RNAs by oligodeoxythymidylate cellulose chromatography. The 5' and 3' RACE cDNA libraries were set up using Clontech SMART RACE cDNA Amplification kit and poly(A) RNA from bovine kidney. Full length cDNA sequence of bovine SGLT1 has been cloned and sequenced. The sequence information of bSGLT1 has been submitted to GenBank with access number AF508807. In addition, the RACE cDNA fragments have also been obtained for bGLUT8 and bSGLT2.

Publications:
(No publications.)

Impact:
Obtaining the full cDNA clones of glucose transporters will help us to study the transport kinetics of each transporter and to study their functional role in supporting milk synthesis in the mammary gland and in maintaining glucose homeostasis in other bovine tissues.

Regulation of amino acid and peptide transporters in ruminant intestine.

Investigators: Knapp, J. R.

Performing Department: Animal Science -- 0331

Start Date: 09/01/1999 Termination Date: 08/31/2002
Reporting period: 09/01/1999 to 08/31/2002
Report was submitted to CRIS on 04/08/2003

Termination Report:
We have been able to determine the presence of three amino acid transporters in bovine intestinal epithelial cells at the RNA and protein (functional transporter) level that are analagous to human amino acid transporter systems L, A, y+, bo+ and y+L. We have also been able to confirm the presence of the peptide transporters PEPT1 and HPT1 at the RNA level.

Publications:
(No publications.)

Impact:
This research provides the basis for more detailed studies on the regulation of amino acid and peptide transport in ruminant livestock.

Transgenic approach to prevent mastitis

Investigators: Kerr, D. E., Plaut, K., Bramley, A. J.

Performing Department: Animal Science -- 0331

Start Date: 12/01/2000 Termination Date: 11/30/2003
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
Progress has be made on our objective to examine a new gene regulatory unit that appears to be relatively silent during normal lactation but will potentially direct lysostaphin production in response to infection. The regulatory unit will be isolated from the bovine genome and will be used for the generation of new transgenic mice that will then be evaluated for mastitis resistance. To date we have isolated 2.5 Kb of the promoter region of our target gene. We plan to clone at least 5 kb for our future transgenic animal project. We have also developed a transfectable bovine mammary cell culture system that will allow us to test the activity of gene constructs containing the new promoter. Currently we are developing techniques to evaluate the gene expression by these cells following infection with mastitis pathogens.

Publications:
(No publications.)

Impact:
This research will lead to a greater understanding of the genes that are activated in mammary epithelial cells in response to infection. Ultimately this knowledge may be of use in prevention of mastitis or in selection or production of disease resistant animals.

High Performance Liquid Chromatography System for Multiple Users

Investigators: Knapp, J. R.

Performing Department: Animal Science -- 0331

Start Date: 09/01/2000 Termination Date: 08/31/2002
Reporting period: 09/01/2000 to 08/31/2002
Report was submitted to CRIS on 04/08/2003

Termination Report:
The HPLC has been purchased, set up and is in operation.

Publications:
(No publications.)

Impact:
More analytical capability for several researchers.

Core Facility Microplate Reader for Multiple Users

Investigators: Hovey, R.

Performing Department: Animal Science -- 0331

Start Date: 11/01/2002 Termination Date: 10/31/2004
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
This grant was initiated on 11/01/2002 and resulted in the procurement of a Biotek Synergy HT microplate reader in the Department of Animal Science at the University of Vermont. Specifically, this Department supports the work of several researchers in the area of lactation and mammary gland biology. The microplate reader has recently been received (1/03) and is now receiving extensive use for a number of different assays. It is being used for luminescence assays (promoter analysis), UV absorbance (DNA, RNA), absorbance (colorimetric protein assays) and fluorescence (Hoescht dye quantitation of DNA). Several future applications of new procedures are planned. The ability to access this equipment has led to significant gains in productivity, efficiency and accuracy of work in the Department.

Publications:
(No publications.)

Impact:
The Lactation and Mammary Gland Biology group within the Department of Animal Science at the University of Vermont addresses fundamental and applied questions concerning lactation biology. The aforementioned equipment is a valuable resource in many basic research applications being used. Ultimately the success of these basic research applications will be translated to applied research that seeks to enhance and manipulate milk production in various species.

Methods to monitor and assess animal health and food safety on dairy farms

Investigators: Barlow, J.

Performing Department: Animal Science -- 0331

Start Date: 10/01/2000 Termination Date: 09/30/2004
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
Progress has been made in the development of methods to characterize antimicrobial sensitivity phenotypes of pathogens isolated from dairy farms. Resistance profiles of Staphylococcus aureus isolates collected from dairy farms that regularly use antibiotics have been compared to farms that severely restrict antibiotic use. The majority of isolates are identified as sensitive, consistent with previous reports that have examined isolates from similar sources. However, farms that used antibiotic treatments had significantly fewer susceptible isolates for the drugs penicllin, sulfamethazole, and tetracycline. Increased resistance to antibiotics that are commonly used on dairy farms can be observed, and individual farm practices may affect resistance patterns of pathogens isolated at the herd level. Possible associations between level and type of antibiotic use on dairy farms and the sensitivity phenotypes of pathogens isolated on those farms are being explored. Methods for recording animal health and treatment events using commercially available micro-computer software programs are being implemented. The ability to conduct prospective studies that investigate the association between antibiotic use practices and antimicrobial resistance patterns on farms is being explored.

Publications:
(No publications.)

Impact:
This project will provide information to assess the risk of development of antibiotic resistance resulting from use of antibiotics on dairy farms.

Characterization of the function of proline-rich cell wall proteins (AtPRPs) in Arabidopsis.

Investigators: Tierney, M.

Performing Department: Botany -- 0510

Start Date: 10/01/1999 Termination Date: 09/30/2002
Reporting period: 10/01/1999 to 09/30/2002
Report was submitted to CRIS on 04/08/2003

Termination Report:
The goals of this project were to develop molecular tools to characterize the regulation and function of a family of plant cell wall proteins (PRPs). Epitope-tagged versions of these proteins were generated and transformed into the model plant Arabidopsis thaliana to determine the localization of these proteins in specific cell types. These studies demonstrated that ATPRP1 and ATPRP3 were localized to the base and tip, respectively, of root hairs and that ATPRP2 and ATPRP4 are deposited within the cell wall of guard cells surrounding the stomatal pore. Mutants have been identified in genes encoding each member of this cell wall protein family. Mutations within ATPRP3 affected root hair branching, seedling growth, number of leaves and time to flowering. In contrast, mutations in ATPRP4 affected gas exchange and respiration rates in both light and dark growth conditions. These results indicate that these cell wall proteins play an important role in determining key aspects of cell physiology that are characteristic of root hairs and guard cells during plant growth.

Publications:
Tierney ML, Hu J, Trott T, Zhang X (2002) Genetic analysis of the function of proline-rich structural cell wall proteins in root hairs and guard cells of Arabidopsis thaliana. American Society of Plant Biology.

Hu, J ML Tierney (2002) AtPRP3, a root hair structural cell wall protein in Arabidopsis thaliana, is important for root hair structure and plant growth. Cell wall biosynthesis Meeting, Lake Arrowhead, CA.

Trott, TD and ML Tierney (2002) AtPRP4, a proline-rich cell wall protein, is localized to the outer cell wall ledges of guard cells of Arabidopsis thaliana.. Cell wall biosynthesis Meeting, Lake Arrowhead, CA.

Zhang, X, ML Tierney (2002) AtPRP1, a proline-rich protein, is localized to the trichoblast cell wall around the base of developing root hairs in arabidopsis seedlings. Cell wall biosynthesis Meeting, Lake Arrowhead, CA.

Impact:
Root hairs and guard cells are two conserved cell types in plants that play important roles in cell physiology during growth and in the interactions that plants have with their environment. A better understanding of the function of PRPs within these cell types may allow us to enhance the ability of plants to successfully withstand specific challenges within their environment during growth and reproduction.

Genetic markers for sap sweetness in Sugar Maple.

Investigators: Currier, W., Baribault, T. J., Perkins, T. D.

Performing Department: Botany -- 0510

Start Date: 10/01/1999 Termination Date: 09/30/2002
Reporting period: 10/01/1999 to 09/30/2002
Report was submitted to CRIS on 04/08/2003

Termination Report:
Our Hatch supported research has sought to: 1. Isolate DNA from Sugar Maple buds and leaves and prepare a catalogue of DNA samples from mature trees. 2. Perform sap sugar concentration assays on mature trees and an experimental plantation of trees selected for sweetness. 3. Correlate sap sugar results with RAPD DNA fingerprints. We have successfully completed the first two of these objectives. We have developed a method based on CTAB extraction which gives consistent results and good yields when used on sugar maple buds. Using this technique we have prepared samples from 20 mature trees of known high or low sap sugar concentration (standard trees) and more than 200 progeny trees from the experimental orchard of the Proctor Maple Research Center. We have also collected sap, and measured sap sugar concentration by refractive index, from the standard trees and the progeny for six years. We have prepared a catalogue of DNA samples from the standard trees and the "sweet tree" progeny to develop a meaningful test for a banding pattern unique to "sweet trees". The most recent six years of sap sweetness data for these trees is also essential. One of us has also generated DNA samples from more that 400 progeny of high sap sugar producing trees in three other states. Over the last three years we have tested 60 10-mers on the DNA extracted from the standard trees and the progeny trees and have found no banding fingerprint that consistently correlates with high sap sugar concentration.

Publications:
(No publications.)

Impact:
The sugar concentration in the sap is one of the most important variables in maple syrup production. Sugar maple (Acer saccharum Marsh.) sap sweetness varies from less that 0.7% to more than 10% with the average tree at about 2%. As abandoned fields in Vermont begin to revert to forest there is an opportunity to establish plantations of "sweet trees". Older sugarbushes will also need some replacement trees. Both of these needs could be met by a supply of genetically superior trees. In this work we have used modern techniques to try to characterize maple trees with high levels of sucrose in their sap.

A Novel Approach for Developing PDE Models of the Spread of Invasive Species

Investigators: Hoffmann, J., Bentil, D.

Performing Department: Botany -- 0510

Start Date: 10/01/2000 Termination Date: 09/30/2003
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
Our focus during this past year has been two fold. (1) We have made significant advances in the generalization of the partial-differential equation (PDE) models of invasive species spread dynamics. Habitat heterogeneity via advective forces and a generalization of the growth dynamics that can account for linear, non-linear, and Alee-effect density dependence have been successfully incorporated into the PDE models. A journal paper has been submitted describing this work. (2) We have completed the software development and feasibility experiments on model selection with our genetic algorithm and have shown that our evolutionary computation approach can successfully carry out simultaneous model selection and fitting. Results from this part of the project have been presented at an international meeting and are being published in a special journal edition of biological applications of evolutionary computation. This year we also set up a web page to broadly disseminate the results from this project and to make available the software tools we have developed (http://www.uvm.edu/~jphoffma/models). Over the remaining six months of this project we anticipate completing (1) the remaining extensions to the suite of PDE invasive species models (short and long distance dispersal), and (2) the final testing with invasive-species field data.

Publications:
Hoffmann, J.P., Ellingwood, C.D., Bonsu, O.M. and Bentil, D.E. 2002. Turning genes off and on: Using genetic algorithms with complexity-based fitness for model selection in ecology. . Proceedings of the Genetic and Evolutionary Computation Conference (GECCO-2002) - Workshop Special Session on Biological Applications of Evolutionary Computation, pp 38-40.

Hoffmann, J.P., Ellingwood, C.D., Bonsu, O.M. and Bentil, D.E. 2003. Ecological model selection via information theory and evolutionary computation. Invited paper for a special issue of the Journal of Genetic Programming and Evolvable Machines 4(4).

Bentil, D.E., Ellingwood, C.D., Osei, M.B. and Hoffmann, J.P. 2003. On a Unified Model for Growth based upon Schnute's Postulates. Submitted to Mathematical Biosciences.

Impact:
Global warming is predicted to alter the range of species and increase the number of disruptive invasions. Managing these invasions in complex ecosystems depends on good predictive models of invasive species dynamics. This project is helping to provide those models which can be used to evaluate the efficacy of various control strategies via simulation.

A Molecular approach to the visualization of lateral root development in the model legume, Medicago truncatula

Investigators: Harris, J.

Performing Department: Botany -- 0510

Start Date: 10/01/2001 Termination Date: 09/30/2004
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
As a result of a symbiosis with nitrogen-fixing rhizobium bacteria, legumes are relieved of a dependence on additional fertilizer. Only legumes can form this symbiosis. Perhaps differences in legume development have allowed the interaction with rhizobium to evolve. In particular, we are interested in the possibility that changes in the development of lateral roots may have predisposed legumes to form a symbiosis with rhizobia. We are examining the development of lateral roots in the model legume, Medicago truncatula, to see if it differs from non-legumes. We have generated plasmid constructs containing molecular reporters and have begun setting up a plant transformation system for M. truncatula.

Publications:
(No publications.)

Impact:
If we could understand what unique aspects of legume development allow them to interact with nitrogen-fixing rhizobium bacteria, we might be able to improve the ability of non-legumes to grow in the absence of commercial fertilizer.

Determination of presumed invasive traits in populations of Phalaris arundinacea

Investigators: Molofsky, J.

Performing Department: Botany -- 0510

Start Date: 10/01/2002 Termination Date: 09/30/2005
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
Individuals of Phalaris arundinacea were collected from three populations from each of four locations: two in the native European range and two in the non-native United States range. Location for plant collections were chosen as the middle and the southern extent of Phalaris' range in Europe and the United States. In Europe, we chose the Czech Republic and southern France; in the United States, we chose Vermont and the foothills of the Smoky Mountains in North Carolina. Therefore, by choosing individuals taken from the center and southern limit of Phalaris' range in both its native and non-native range, we have a representative sample of genotypes of Phalaris arundinacea. From each of three populations at each of the four locales (Czech Republic, France, Vermont, North Carolina), we collected thirty rhizomes of and transported them to the UVM greenhouse. Plants are currently being propagated for use in greenhouse and field experiments. From these collections, we will select four genotypes from each of the populations (12 genotypes per geographic locale, 48 genotypes total). Identification of genotypes within the populations will be done using starch gel-electrophoresis. These known genotypes will be used in our experimental studies.

Publications:
(No publications.)

Impact:
By asessing plant survivorship and growth of individuals of Phalaris arundinacea collected from both its native and introduced range in common garden and controlled greenhouse studies, we will determine how specific phenotypic traits from these different populations contribute to the invasive ability of Phalaris arundinacea.

Global change effects in timing and physiology of maple sap exudation

Investigators: Perkins, T. D., Wilmot, T. R.

Performing Department: Botany -- 0510

Start Date: 10/01/2002 Termination Date: 09/30/2005
Reporting period: 10/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
Because the mechanism of maple sap flow is driven diurnal fluctuations in temperature, global warming has the potential to significantly impact the timing and duration of maple production. This project aims to examine historical trends in maple production in relation to climate, and to develop a model of maple sap flow in an effort to better understand the possible effects of changing climate on the maple industry.

Publications:
(No publications.)

Impact:
This work will provide maple sugar makers with better information to plan for possible changes in the maple industry.

Analysis of arabidopsis mutants altered in biofilm formation

Investigators: Tierney, M. L.

Performing Department: Botany -- 0510

Start Date: 10/01/2002 Termination Date: 09/30/2005
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
The long term goal of this research is to identify and characterize plant factors that are important in the establishment and maintenance of plant root colonization by Pseudomonas fluorescens. The goal of this project is to characterize the pattern of association that P. fluorescens has with the roots of Arabidopsis thaliana and to use this information to identify arabidopsis mutants that are altered in their ability to interact with the bacteria. We have shown that within two hours, P. fluorescens is capable of binding to arabidopsis roots. The binding is established in a distinct pattern, with bacteria first adhering to the grooves between cells in the root and later binding to the epiderminal surfaces themselves.

Publications:
Burns, M, ML Tierney (2002) Identification of an Arabidopsis thaliana mutant that shows enhanced colonization by Pseudomonas fluorescens by biocontrol strain WCS365. Cell wall biosynthesis Meeting, Lake Arrowhead, CA.

Impact:
Beneficial interactions between P. fluorescens and plant roots has been shown to increase plant nutrition and the resistance of plants to many types of bacterial and fungal pathogens. An understanding of the factors controlling this process may allow us to modify crop plants in a manner that will make them more resistant to disease-causing organisms.

Genetic limits to ecological range expansion of cattails

Investigators: Stratton, D. A.

Performing Department: Botany -- 0510

Start Date: 12/01/1999 Termination Date: 11/30/2002
Reporting period: 12/01/1999 to 11/30/2002
Report was submitted to CRIS on 04/08/2003

Termination Report:
The primary goal of this seed grant was to develop a set of molecular markers in cattails that can be used to create a genetic linkage map. During this project we identified over 100 AFLP markers that are polymorphic between two common species of cattails, Typha latifolia and T. angustifolia. To start construction of the geneetic linkage map, we generated F2 progeny from crosses between the two parental species.

Publications:
(No publications.)

Impact:
The development of these molecular markers will allow us to begin a genetic analysis of species differences in cattails. Cattails have well-characterized habit requirements, so they are an excellent model system to understand the genetic basis of ecological range limits in plants.

Phenotypic plasticity or genetic specialization in an invasive grass.

Investigators: Molofsky, J.

Performing Department: Botany -- 0510

Start Date: 09/15/1999 Termination Date: 03/14/2003
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
(No Report narrative.)

Publications:
(No publications.)

Impact:
The high variation found within populations taken from both pasture and wetlands suggests that such variation may be responsible for the species invasive success. Further studies are needed to determine how this genetic variation translates into invasiveness in this species.

The Fate of Heavy Metals and Other Contaminants of Maple Sap and Syrup

Investigators: Perkins, T. D.

Performing Department: Botany -- 0510

Start Date: 07/01/2001 Termination Date: 06/30/2003
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
Contaminants, especially lead, are sometimes introduced into maple sap during the collection and processing of sap into maple syrup. This work will identify and rate potential areas of contamination and adulteration of maple products and educate producers on how to reduce exposure during maple production. Another contaminant of concern is paraformaldehyde, which has been banned from use by the U.S. and Canada, but is still occasionally used in limited areas. Research will focus on determining the natural levels of PF in maple sap, and the levels of PF in maple syrup made from sap containing PF. In addition, denatured alcohol has been approved for use as a tubing cleaner and taphole sanitizer in Quebec. We will evaluate the efficacy of this product and determine whether unwanted residues carry through to syrup.

Publications:
(No publications.)

Impact:
This research will allow maple sugarmakers to reduce contaminant levels in their maple products by limiting exposure to materials containing lead and other undesireable residues, as well as help to ensure a quality and safe consumer product.

Sugar Maple DNA Fingerprinting

Investigators: Baribault, T. J.

Performing Department: Botany -- 0510

Start Date: 09/01/2000 Termination Date: 08/31/2003
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
Sap sampling from half-sib family plantings in Massachusetts and Ohio, as well as from clonally-propagated sweet trees in Ohio was initiated in 2002. Leaf DNA isolation from these additional trees was begun in summer 2002 and will be completed by summer 2003. A complete set of sap tests were performed on Vermont trees as well. DNA purification from these Vermont grown trees was 90% complete by the start of 2003. About half of these DNA's were initially tested in PCR assays with primers that flank the amino terminal 1300-bp region of the sugar maple RuBisCO large subunit gene. A database of fragment patterns was then established. Further amplifications with a subset of decamer primers that gave promising, multiple fragment patterns with DNA of a single test tree in 1998 failed to yield consistent RAPD bands across three of the half-sib families grown in Vermont. Fragment polymorphism analysis will be expanded to the remaining half-sib families in 2003 using a different set of primers. Controlled pollination in the Vermont orchard failed to produce useable seed populations for the third successive year. Seeds of the one successful cross were planted late in 2002 to begin the next generation for DNA fingerprinting. Sap records of previous years will help determine which crosses will be attempted in 2003. Of the sexually mature half-sibs, flower phenology was further defined in spring '02. This information will be important for the timing of pollen application in May '03. Since 2001 was a bumper seed year for Vermont, while 2002 was very poor, the next year will likely not be too high above average. In summary, correlations between sap data gathered from 3 separate locales (but from genetically related individuals) in 2002 and RAPD fragments of the same trees will be made as the fragment reproducibility problem is adequately addressed. Efforts to produce the third (and necessary) generation for a QTL mapping population are underway but likely to require additional growing seasons beyond the time frame of this funded study.

Publications:
(No publications.)

Impact:
Maple syrup is a 200 million-dollar industry annually in Vermont and is of considerable agricultural importance in a dozen other northern states. Since sap sweetness is a major factor in sustainability, most producers could realize significant reductions in fuel and labor costs through modest genetic improvement in sugar maple tree replacement stocks. Correlations between sap sucrose content and DNA fingerprint patterns are presently being established with additional sources of covariation due to geographic location and overall weather factored into the calculation. These results will then be used to select more valuable seedlings from controlled crosses and from open-pollinated, elite trees.

QTL analysis of traits that limit ecological range expansion in cattails.

Investigators: Stratton, D. A.

Performing Department: Botany -- 0510

Start Date: 09/01/2000 Termination Date: 08/31/2003
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
We have generated the F2 progeny from the cross between two cattail species, and we are continuing to characterize those lines, both genetically and phenotypically. The phenotypic analysis shows that the characters that distinguish the two species segregate in the cross and show evidence of polygenic control. Once the genotyping is complete we will be able to test for associations between those characters and particular marker loci.

Publications:
(No publications.)

Impact:
To understand the genetic and evolutionary constraints on range expansion of species, it is important to determine the genetic architecture of traits that limit plant performance along ecological gradients. Results from this model system will help us understand the evolutionary potential of other invasive species and the evolutionary tradeoffs that may limit a species ability to invade new habitats.

Solubility and distribution of trace elements in milk based infant formula.

Investigators: Guo, M. G., Tyzbir, R.

Performing Department: Nutritional Sciences -- 1670

Start Date: 10/01/1999 Termination Date: 09/30/2002
Reporting period: 10/01/1999 to 09/30/2002
Report was submitted to CRIS on 04/08/2003

Termination Report:
Solubility and bioavailability of minerals (e.g., Zinc, Iron and Copper)in infant formula may be affected by the forms of the added salts as well as the oxidation state of the mineral. To maintain a reduced environment in infant formula, high levels (200-300% RDA) of antioxidants (ascorbic acid and vitamin E) were added to the experimental whey protein dominated infant formulas. The solubility of Fe, Cu, and Zn in the formulas were analyzed by mineral distribution on centrifugation at 45,000 X g at 4C for 2 h. The results showed that there were no significant effects on the solubility of Fe, Cu, or Zn in the infant formulas by adding high levels of antioxidants. Further research needed to elucidate and verify methods to increase mineral solubility and availability in infant formula.

Publications:
Smith, C.R., M.R.Guo, and R.S. Tyzbir. 2002. The effect of antioxidants on solubility of trace minerals in infant formula. J. Dairy Sci. 85: Suppl. 1. 382.

Impact:
Bioavailability of minerals in infant formula is generally lower than that in human milk. This study was trying to increase mineral bioavailability through formulation by using high levels of antioxidants (Vc and VE) to remain selected minerals in reduced form. Our results indicate that adding high levels of the antioxidants may not have direct effects on mineral solubility in the experimental formula.

Improved Procedures for Enumeration of L. monocytogenes in Ready-to-eat Foods

Investigators: Donnelly, C. W.

Performing Department: Nutritional Sciences -- 1670

Start Date: 10/01/2000 Termination Date: 09/30/2003
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
Listeria monocytogenes causes the highest rate of death and hospitalization of any foodborne pathogen, and recent outbreaks have been attributed to low levels of contamination in food products. Existing methods for the detection of L. monocytogenes lack the sensitivity needed for detection of low-level healthy or injured cells. In this Hatch project, our efforts to develop improved and sensitive enumeration procedures for the detection of Listeria monocytogenes in foods continues. In the past year, the current USDA/FSIS MPN procedure utilizing UVM broth was compared to a modified system using a) Listeria Repair Broth (LRB) and b) UVM combined with LRB with a 4 hr nonselective recovery period prior to the addition of selective agents (UVM/LRBS). Three ready-to-eat (RTE) foods were analyzed: hot dogs; smoked salmon; and fermented sausage. The products were inoculated with <10 L. monocytogenes/g. The methods used followed the USDA/FSIS MPN procedure. Isolation and identification of L. monocytogenes was performed by plating MPN enrichment to Oxford and Palcam agar plates and conducting appropriate biochemical testing. The MPN system using LRBS detected Listeria at a level of approximately 10MPN/g, and significantly outperformed procedures using UVM and UVM/LRBS when the food was inoculated with <10 CFU/ml of healthy cells. Higher levels of detection were obtained from fermented sausage than from hot dogs or smoked salmon. It appears that LRBS is able to detect low-levels of healthy Listeria better than UVM or UVM/LRBS. Detection of low levels of injured Listeria was improved using UVM/LRBS when compared to UVM or LRBS, detecting approximately 15 MPN/g when food was inoculated with <100 CFU/ml of L. monocytogenes with an injury level of 99.6%. In food products which have been linked to outbreaks of listeriosis, sodium nitrite (NaNO2) is used as a curing agent and preservative. Few, if any studies, have been conducted to determine if NaNO2 can sublethally injure Listeria. Since three of our study foods in objective 3 are nitrite-containing foods, it was necessary to include the following study objectives: examine the impact of NaNO2 on injury of L. monocytogenes; examine if nitrite injury is reversible, and compare recovery of L. monocytogenes from frankfurters containing nitrite using Listeria Repair Broth (LRB) and UVM Modified Listeria Enrichment Broth (UVM). NaNO2, when used at concentrations of 100 and 200 ppm, was found to injure L. monocytogenes. The injury was completely reversible, or growth of uninjured Listeria occurred in LRB when injury was between 98.5 and 98.7%. UVM broth was unable to reverse the effects of nitrite injury. With respect to time, inoculum and meat type, LRB was found to be consistently superior to UVM at recovering L. monocytogenes from frankfurters. Nitrite injury is a factor influencing detection and recovery of L. monocytogenes from frankfurters and other nitrite-containing foods. Our research to date documents that continued efforts must focus on improving the sensitivity of detection of Listeria in high risk foods and those which contain compounds, such as nitrites which may injure Listeria and mask detection.

Publications:
Silk, T.M., T.T. Roth and C.W. Donnelly. 2002. Comparison of growth kinetics for healthy and heat-injured Listeria monocytogenes in eight enrichment broths. J. Food Prot. 65:1333-1337.

Donnelly, C.W. 2002. Detection and isolation of Listeria monocytogenes from food samples: Implications of sublethal injury. J. AOAC International 83:495-500.

Ngutter, C.M. and C.W. Donnelly. 2003. Nitrite-induced injury of Listeria monocytogenes:impact of selective versus non-selective recovery procedures on the isolation of L. monocytogenes from frankfurters. Abstr. Annual Meeting IAFP, New Orleans (accepted).

Groves, E., T.M. Silk and C.W. Donnelly. 2003. Comparison of MPN procedures designed for recovery of low-level healthy and injured L. monocytogenes in ready-to-eat foods. Abstr. Annual Meeting IAFP, New Orleans (accepted).

Silk, T.M. And C.W. Donnelly. 2002. Detection of Listeria monocytogenes in yogurt and cold pack cheese using enzyme-linked immunofluorescent assays. J. Dairy Sci. Suppl. 85:152.

Ngutter, C.M. 2002. Control and recovery of Listeria monocytogenes in frankfurters. Ph.D. Thesis, University of Vermont, Burlington. 117 pp.

Impact:
The expected impact of this research will be the identification of enumeration procedures which will allow the complete detection of low levels of Listeria monocytogenes in high risk food products. Identification of Listeria-contaminated foods will assist in preventing entry of these products into commerce and should facilitate further reductions on illnesses and deaths due to L. monocytogenes.

A novel model system to study the independent effect of pH on cheese properties

Investigators: Kindstedt, P. S.

Performing Department: Nutritional Sciences -- 1670

Start Date: 10/01/2000 Termination Date: 09/30/2003
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
The present objective was to determine the independent effect of pH on the physico-chemical, proteolytic and functional characteristics of low-moisture, part skim Mozzarella cheese during aging. A novel post-manufacture approach was used to increase (ca. 0.3 pH units) and decrease (ca. 0.2 pH units) the cheese pH immediately after manufacture. Control and pH-adjusted cheese samples were stored at 4 C for up to 40 days and analyzed periodically for apparent viscosity, free oil, pH 4.6 soluble N, 12% TCA soluble N, water soluble calcium, meltability and TPA hardness and springiness. The experiment was repeated using three separate batches of cheese. Data were analyzed by ANOVA according to a split-plot design. Changing the pH of Mozzarella cheese resulted in significant changes in water soluble calcium content, apparent viscosity, meltability and TPA hardness. Increasing the pH resulted in lower water soluble calcium, higher apparent viscosity and TPA hardness, and lower meltability throughout 40 days of refrigerated storage. Conversely, decreasing the pH resulted in higher water soluble calcium, lower apparent viscosity and TPA hardness, and higher meltability levels throughout 40 days of refrigerated storage. In contrast, free oil, pH 4.6 soluble N and 12% TCA soluble N were not significantly affected by the changes in pH. The data indicate that proteolysis in Mozzarella cheese was not affected by changing the pH of the newly-made cheese within the range of values studied. In contrast, the distribution of calcium underwent immediate changes upon altering the pH, which presumably contributed directly to the significant changes in functional characteristics (apparent viscosity, meltability, TPA hardness) that were observed. Thus, post-manufacture manipulation of pH at the start of aging could potentially be developed into a powerful tool for manipulating the functional characteristics of Mozzarella cheese during aging and beyond. In a related study, the pH of fully aged low-moisture, part skim Mozzarella cheeses was either increased and subsequently decreased to the original value, or decreased and subsequently increased, using a novel post-manufacture approach, in order to determine whether pH-induced changes in calcium distribution and functionality are reversible. Reversing the cheese pH resulted in an immediate reversal in water soluble calcium levels and apparent viscosity. These data demonstrated that the functional characteristics of both newly made and aged Mozzarella cheeses may be manipulated by post-manufacture pH adjustment. Furthermore, the data support the view that calcium distribution profoundly influences functional characteristics.

Publications:
Ge, Q., M. Almena-Aliste and P.S. Kindstedt. 2002. Reversibility of pH-induced changes in the calcium distribution and melting characteristics of Mozzarella cheese. Aust. J. Dairy Technol. 57:3-9

Kindstedt, P.S. 2002. Pasta-filata Cheeses. Chapter in Encyclopedia of Dairy Sciences, H. Roginski, J.W. Fuquay and P.F. Fox, ed. Academic Press, London. pp.386-391

Cortez, M.A.S., M.M. Furtado, and P.S. Kindstedt. 2002. Comparison of three methods to quantify water soluble calcium in Mozzarella cheese. 2. Effect of short-term aging. J. Dairy Sci. 85(Suppl. 1): 90

Cortez, M.A.S., M.M. Furtado, M.L. Gigante and P.S. Kindstedt. 2002. Effect of post-manufacture modulation of cheese pH on the aging behavior of Mozzarella cheese. J. Dairy Sci. 85(Suppl. 1): 256

Gigante, M.L., M. Almena-Aliste and P.S. Kindstedt. 2002. Effect of potassium sorbate addition on the viscosity of aqueous solutions of locust bean gum during storage at 4 and 20 C. J. Dairy Sci. 85(Suppl. 1): 120

Almena-Aliste, M., M.L. Gigante and P.S. Kindstedt. 2002. Reversibility of pH-induced changes in the texture and serum phase of cultured cream cheese. J. Dairy Sci. 85(Suppl. 1): 255

Impact:
Approximately 2.3 billion pounds of Mozzarella cheese are produced annually in the U.S. This research has opened the door to the potential development of powerful new tools that Mozzarella cheesemakers can use to control and tailor the quality of their cheese.

The impact of added sugars on the quality of children's diets

Investigators: Johnson, R. K.

Performing Department: Nutritional Sciences -- 1670

Start Date: 10/01/2000 Termination Date: 09/30/2003
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
The purpose of this project is to determine associations between intakes of the primary food and beverage sources of added sugars and intakes of key nutrients and food pyramid groups among U.S. children ages 6-17 years. The 1994-96 and 98 USDA Continuing Survey of Food Intakes by Individuals (CSFII) were used to examine the diets of U.S. children. The nationally representative sample (n=3,038) included children age 6-11 years (n=1,913) and adolescents 12-17 (n=1,125). The consumption of sweetened dairy products was positively associated with calcium intakes. Consumption of presweetened cereals increased the likelihood of the children meeting recommendations for the essential shortfall micronutrients calcium, folate, and iron while the consumption of sugar-sweetened beverages, sugars and sweets, and sweetened grains decreased the likelihood of meeting the DRI for these nutrients. Only children who were nonconsumers of sugar-sweetened beverages had a mean calcium intake that met the AI. Consumption of sweetened dairy products and presweetened cereals was positively associated with the number of dairy servings consumed per day.

Publications:
Coulston AM, Johnson RK. Sugar and Sugars: Myths & Realities. J Amer Diet Assoc 2002;102:351-353.

Johnson RK, Frary C, Wang MQ. The impact of flavored milk on total milk intake and the diet quality of U.S. school-aged children. J Amer Diet Assoc, 2002;102:853-856.

Kramer JL, Dwyer J, Hoelscher DM, Nicklas T, Johnson RK, Schulz GK. Fostering healthy food consumption in schools: Focusing on the challenges of competitive foods. J Amer Diet Assoc 2002;102:1228-1233.

In press - Frary CD, Johnson RK, Wang MQ. Children's choices of food and beverages high in added sugars impact their diet quality. J Adol Health, 2003.

In press - Murphy S, Johnson RK. The scientific basis of recent U.S. guidance on sugars intake. J Nutr, 2003.

Frary CD, Johnson RJ, Wang MQ. Children's Choices of Foods and Beverages High in Added Sugars Impact their Diet Quality. The FASEB Journal, 2002; A227, 193.5.

In press - Frary C, Johnson RK. Energy. In: Mahan LK, Escott-Stump S, eds. Krauses's Food, Nutrition & Diet Therapy. Philadelphia, PA W.B. Saunders Company, 2003.

Impact:
The results suggest that intakes of sweetened dairy foods and beverages and presweetened cereals had a positive impact on children's diet quality, while sugar-sweetened beverages, sugars and sweets, and sweetened grains had a negative impact on children's diet quality.

Ultrasonic treatment of milk and apple cider; a potential processing alternative

Investigators: Guo, M. R.

Performing Department: Nutritional Sciences -- 1670

Start Date: 10/01/2002 Termination Date: 09/30/2005
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
Heat treatment is widely used to pasteurize milk and other fluid food products. Although heating can kill pathogens, it can cause undesirable side effects such as loss of nutrients, and unacceptable changes in color and flavor. The objective of this study is to use ultrasound as an alternative means to treat milk and other liquid food products. Samples were treated using a digital Sonifier (Model 450W, Branson Ultrasounics Co.) at a constant frequency (20 kHz) and 110 W ultrasonic output power that was measured calorimetrically with a thermocouple. Ultrasound treatment of raw milk resulted in 99.9% reduction of overall organisms after three minutes of sonification. Levels of Listeria monocytogenes inoculated milk samples reduced from 7.53 log CFU/ml to 6.04 log CFU/ml after three minutes of treatment. Further studies are needed to investigate the effects of ultrasound on pathogens in combination with mild heating. A continuous ultrsound treatment system will be set up for this research.

Publications:
M.R. Guo, T. Silk, and J. Wu. 2002. Effect of ultrasound treatment on total bacteria and Listeria monocytogenes levels in milk. J. Dairy Sci. 85 (Suppl. 1): 380.

Impact:
Results of this study show that ultrasound treatment may be a promising alternative method to the conventional treatment for the milk and apple cider industries to process their products without significant damages on nutrients.

Developing an Environmentally Friendly Wood Finish Coating Based on Cheese Whey Proteins

Investigators: Guo, M.

Performing Department: Nutritional Sciences -- 1670

Start Date: 06/01/2000 Termination Date: 05/31/2002
Reporting period: 06/01/2000 to 05/31/2002
Report was submitted to CRIS on 04/08/2003

Termination Report:
The objective of this project was to develop an environmentally safe wood finish coating prototype product using whey protein as a co-binding material. Thermally denatured whey protein isolate (WPI) solution was incorporated into a waterborne resin (acrylic or polyurethane) based environmentally safe wood finish coating mix at different protein levels. The physicochemical properties (pH, density, viscosity, drying time, hardness, and etc.) of the coating mix and/or the films were examined in comparison to selected commercial wood finish products. The new WPI-resin coating products exhibited excellent mechanical and water resistance properties while released a much smaller amount of volatile organic compounds (VOCs) than the commercial wood finish products. The results show that the newly formulated environmentally safe wood finish coating prototype products may be used as alternatives to high VOCs containing commercial products for coating furniture, toys, and other high-end wooden products. We are in the process of filing a U.S. patent on our research findings. Meanwhile, we are also working on the procedure and an experimental setup to examine the effects of protein incorporation and type and level of biocides on the mold resistance properties of the coating products, from which the results can provide useful information to tailor the wood finish coating formulations for various coating applications with desirable mold resistance.

Publications:
(No publications.)

Impact:
This project is expected to develop an environmentally safe wood finish coating product using cheese whey proteins as a primary binding material. The results showed that whey proteins can be used to formulate environmentally safe wood finish. If successful, it will be beneficial not only to wood and dairy industries, but also to the environment and consumers.

The impact of interviewer Body Mass Index on underreporting of energy intake in obese women.

Investigators: Johnson, R. K.

Performing Department: Nutritional Sciences -- 1670

Start Date: 07/01/2000 Termination Date: 01/31/2003
Reporting period: 07/01/2000 to 01/31/2003
Report was submitted to CRIS on 04/08/2003

Termination Report:
The objective of this study was to determine if overweight and obese women provide more accurate reports of their energy intake by 1) in-person recall with an obese interviewer 2) in-person recall with a lean interviewer; or 3) telephone recall with an unknown interviewer. Eighty-eight overweight and obese women participated in this study. Subjects completed one telephone-administered multiple-pass 24-hour recall (MP24R) with an unknown interviewer and were then randomly assigned to an in-person MP24R with either the lean or obese interviewer to gather reported energy intake (rEI). Basal metabolic rate (BMR) was measured using the Deltrac monitor, and physical activity (EEPA) was estimated using the Caltrac accelerometer. Therefore, estimated energy expenditure was determined by: estTEE = (BMR +EEPA) x 1.10. No significant differences were found between the two in-person interview modes for subject age, weight, BMI, percent body fat, total energy expenditure, rEI and misreporting of energy intake. In-person recall data were combined for comparison with the telephone recalls. No significant difference was found between the in-person and telephone recalls for rEI and misreporting. Mean reported energy intake was significantly lower than estimated total energy expenditure for the telephone recalls and combined (lean and obese modes) in-person recalls.

Publications:
McKenzie DC, Johnson RK, Harvey-Berino J, Gold BC. The impact of interviewer body mass index on underreporting of energy intake in overweight and obese women. Obesity Research 2002;10:471-477.

Friedman A, Johnson RK. Doubly labeled water: new advances and applications for the practitioner. Nutr Today 2002;37:243-249.

Johnson RK. Dietary intake - how do we measure what people are really eating? Obesity Research 2002;10:63S-68S.

Johnson RK, McKenzie D. Energy Requirement Methodology. In: Coulston A, Rock C, Monsen E, eds. Nutrition in the Treatment and Prevention of Disease. San Diego, CA: Academic Press, 2001.

McKenzie D, Johnson RK. Analysis, Presentation, and Interpretation of Dietary Data. In: Coulston A, Rock C, Monsen E, eds. Nutrition in the Treatment and Prevention of Disease. SanDiego, CA: Academic Press, 2001.

McKenzie DC, Johnson RK, Harvey-Berino J, Gold BC. The impact of interviewers' body mass index on underreporting of energy intake in overweight and obese women. The FASEB Journal, 2002; A660, 495.5.

In press - Johnson RK, Hankin JH. Dietary Intake Methodology. In: Monsen ER, ed. Research: Successful Approaches. Chicago, IL: The American Dietetic Association, 2003.

In press - McKenzie D, Johnson RK. Carbohydrates. In: Katz SH, ed. Encyclopedia of Food. New York NY: Charles Scribner's Sons, 2003.

In press - Frary C, Johnson RK. Energy. In: Mahan LK, Escott-Stump S, eds. Krauses's Food, Nutrition & Diet Therapy. Philadelphia, PA W.B. Saunders Company, 2003.

Impact:
This study found that interviewer BMI had no impact on self-reported energy intake during an in-person MP24R, and that telephone recall data were comparable to in-person recalls. Underreporting was a widespread problem (about 26%) for all modes in this sample.

Develop an Environmentally friendly wood finish coating system using cheese whey as a primary binding material

Investigators: Guo, M.

Performing Department: Nutritional Sciences -- 1670

Start Date: 07/01/2001 Termination Date: 06/30/2004
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
The objective of this project was to develop a water-based environmentally safe wood finish product using cheese whey protein as a co-binding material. In our previous work, thermally denatured whey protein isolate (WPI) solution was incorporated into a waterborne resin (acrylic or polyurethane) based environmentally safe wood finish coating mix to formulate a novel wood finish prototype product. The new WPI-resin coating products exhibit excellent mechanical and water resistance properties while contain a much smaller amount of organic solvents than the commercial finish products. A U.S. provisional patent has been filed on these research findings. A follow-up study was then carried out to test the mold resistance of the prototype coating products in comparison to a selected commercial water-based wood finish. Preliminary results revealed that the degree of mold resistance of the coating formulations was related to the level of protein incorporation and type and level of biocides used. Generally, coating formulations with higher level of biocides achieved better mold resistance, whereas increasing protein level increased the rate of mold growth. On the other hand, a faster rate of mold growth was observed on the commercial wood finish coating compared to our coating formulations. We are now working on another trial to verify the preliminary trial results. The mold resistance test can provide useful information in tailoring the wood finish coating formulations for various coating applications with desirable mold resistance. In next studies, the structure-property relationship of the wood finish coatings will be examined and the scale-up trials for future production of the coating products will also be explored.

Publications:
Li, J. and Guo, M. R. 2002. Develop an environmentally safe wood finish product using whey protein as a co-binding material. J. Dairy Sci. 85(Suppl. 1):380.

Wright, N. C. and Guo, M. R. 2002. Characterization of an environmentally safe wood finishes containing whey proteins. Book of Abstracts, PMSE 0171. 224th ACS National Meeting, August 18-22, Boston, MA.

Impact:
Commercial wood finish products predominantly contain volatile organic solvents, which are detrimental to air quality and harmful to the human health. The goal of this project was to develop an environmentally friendly wood finish product using cheese manufacturing by-product (whey protein) as a binding material. If successful, it will be a win-win situation for wood and dairy industries, environmental protection, and consumers.

Development of Environmentally Friendly Snow/Ice Melting Products from Cheese Whey

Investigators: Guo, M.

Performing Department: Nutritional Sciences -- 1670

Start Date: 07/01/2002 Termination Date: 06/30/2005
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
We started this research in July of 2002. A fermentation specialist has been hired. The key instruments and starter cultures have been purchased. Preliminary experiments are being conducted in the laboratory. Our initial results showed that both sweet whey and acid whey can be used for this purpose.

Publications:
(No publications.)

Impact:
Conventional snow/ice melting agents are harmful not only to the environment, but to highways, bridges, and cars. This study is aimed to use agricultural byproduct-cheese whey to convert lactose to organic salt to replace NaCl. If successful, use of the alternatvie deicer for road maitainenance will be benefical to the environment, highway systems, and the dairy industry.

A Novel Approach for Delivering Nutrition, Food Safety and Health Information to Vermont's Elderly.

Investigators: Pintauro, S. J., Berlin, L., Burczy, S. A.

Performing Department: Nutritional Sciences -- 1670

Start Date: 10/01/2000 Termination Date: 09/30/2003
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
Many elderly Vermonter's are at increased risk for nutritional deficiencies and food borne illnesses due to various factors associated with aging, including physical disabilities, chronic diseases, social isolation, and sensory losses. In an effort to reduce this risk, it will be necessary to provide these individuals with new and better opportunities to access information and provide education that can help them adopt practices that promote good health. Computer and information technologies will play a critical role in providing these new informational and educational opportunities. The objectives of this study, therefore, are to 1) develop a user-friendly computer application that will provide nutrition, food safety and health information tailored to the needs of Vermont elders, and 2) to evaluate the effectiveness of the computer application in improving health and nutrition practices and computer technology attitudes in this population. At present, development of the computer application has been completed. The computer program provides the user with tailored video messages, built around the constructs of the Health Belief Model. The program also provides the user with an email account, interactive nutrition and health games and activities, a discussion board to post questions and comments to a study dietician, and additional videos and text on topics of general interest to seniors. In May of this year, we conducted a focus group study to fine tune the computer application and the evaluation instruments. Following minor changes to the program based on focus group feedback, two touch screen computers with broadband Internet access were installed at the Waterbury Area Senior Center (Experimental Group) and at the Randolph Senior Center (Control Group). Approximately 25 volunteers were recruited from each of these senior centers to participate in the project. At the Watebury site, we also recruited and trained six peer mentors to assist participants in the use of the computer programs. Following an orientation meeting at which informed consent was obtained from all volunteers, participants at both the Waterbury and Randolph sites completed the baseline evaluation instruments (NSI Checklist, Food Behavior Questionnaire, Health Belief Model Survey, and Computer Attitude Survey). Participants at the Waterbury site were then encouraged to make complete use of the computer program over the next 12 months. Participants at the Randolph site (control group) were encouraged to use the available computers as often as they like and for whatever purpose they chose, but without access to our nutrition and health computer program and without assistance from mentors. We are now in the process of administering the three month follow-up evaluation instruments to all participants at both sites. The same survey instruments will be administered to all participants 12 months after initiation of the study. The results of this project will further our understanding of the benefits of computers for delivering nutrition and health information and for improving health behaviors of the elderly.

Publications:
Harvey-Berino J, Pintauro SJ, Gold BC. (2002) The Feasibility of Using Internet Support for the Maintenance of Weight Loss. Behavior Modification, 26(1):103-116.

Buzzell, P.R., Chamberlain, V., and Pintauro, S.J. (2002). The Effectiveness of Web-Based, Multimedia Tutorials for Teaching Methods of Human Body Composition Analysis. Adv. Physiol. Educ. 26:21-29.

Harvey-Berino, J, Pintauro, S, Buzzell, P, DiGiulio, M, Casey Gold, B, Moldovan, C, Ramirez, E. (2002). Does Using the Internet Facilitate the Maintenance of Weight Loss? Int. J. Obesity. 26:1254-1260.

Buzzell, P. and S.J. Pintauro, Learning with Technology, in Creative Instructional Methods, V.M. Chamberlain and M.N. Cummings, Editors. 2003, Glencoe McGraw-Hill: New York. p. 201-214.

Impact:
Information technology and the Internet have the potential to deliver health and nutrition information that is tailored to the users particular needs and provided in a user-friendly, multimedia, and interactive format. In addition, the Internet can provide this information to a large group of people who may be geographically isolated or have other limitation to their mobility. Many Vermont seniors would potentially benefit from access to these types of health resources delivered via the Internet. In order to make the most effective use of these technologies, it is essential that we understand which components of the technology are most effective.

NORTHEAST REGION SUSTAINABLE AGRICULTURE RESEARCH AND EDUCATION COOPERATIVE AGREEMENT

Investigators: Magdoff, F. R.

Performing Department: Plant & Soil Science -- 1825

Start Date: 04/01/2000 Termination Date: 03/31/2005
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
Administer USDA SARE Program for the Northeast Region Coordination of the USDA Sustainable Agriculture Research and Education Program for the 12 States in the Northeast Region. Send out calls for proposals, assemble Committees to review proposals and provide guidance. Publish newsletter, INNOVATIONS, and produce other materials for distribution. Oversee contracts with various recipients.

Publications:
INNOVATIONS.2002.Northeast SARE newsletter is issued quarterly.

Impact:
Will help change farming practices to those that are more environmentally , economically, and socially sound.

NORTHEAST REGION SUSTAINABLE AGRICULTURE PROGRAM - PROFESSIONAL DEVELOPMENT

Investigators: Magdoff, F. R.

Performing Department: Plant & Soil Science -- 1825

Start Date: 04/01/1999 Termination Date: 03/31/2004
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
Administer USDA SARE Program for the Northeast Region Coordination of the USDA Sustainable Agriculture Research and Education Program for the 12 States in the Northeast Region. Send out calls for proposals, assemble Committees to review proposals and provide guidance. Publish newsletter, INNOVATIONS, and produce other materials for distribution. Oversee contracts with various recipients.

Publications:
INNOVATIONS.2002. Northeast SARE newsletter issued quarterly.

Impact:
Will help change farming practices to those that are more environmentally , economically, and socially sound.

CONSTRUCTED WETLANDS CENTER FOR RESEARCH, EDUCATION, AND OUTREACH AT THE UNIVERSITY OF VERMONT: PLANT SPECIES SELECTION AND WETLAND DESIGN

Investigators: Foss, D. C., Tignor, M. E., Lewis, T. A., Hession, W. C.

Performing Department: Plant & Soil Science -- 1825

Start Date: 09/15/2001 Termination Date: 09/14/2003
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
The implementation of subsurface constructed wetlands at the University of Vermont's research and education dairy is nearly complete. Four large wetland cells are in place and 12 small research cells will be complete in spring 2003. Research planning is underway to design experiments that will determine the impacts of strategically adding aeration either positionally or temporally on water treatment. Greenhouse research on plant selection to improve phytoremediation of agriculturally impacted water and milkhouse rinsate has begun. Utilizing several batch reactors, greenhouse studies have already indicated that there are major differences in the root growth and development of Scirpus atrovirens plants in aerated and unaerated rhizosphere environments. For example Scirups atrovirens plants in unaerated reactors had nearly twice the surface area of plants in aerated reactors.

Publications:
Whitney, D.H., N.J. Hayden, W.C. Hession, and M.Tignor. 2002. Developing a constructed wetland center at the University of Vermont. Wetlands and Remdiation II. Proceedings of the Second International Conference on Wetlands and Remediation. Battelle Press:Columbus, OH. pp. 243-249.

Whitney, D.H. 2002. The effect of aeration on the treatment of organic and nitrogen compounds in a laboratory-scale constructed wetland system. M.S. Thesis. University of Vermont.

Impact:
Treating dairy wastewater in the unique and harsh climate of Vermont presents special challenges. This project will target improving wastewater management utilizing phytoremediation technology in a subsurface constructed wetland at the UVM dairy. The overall constructed wetland project has several goals, including increasing the understanding of the plant's role in remediation of agricultural wastes and engaging students in active research involving a 'real world' problem. However, ultimately the research is designed to reduce the environmental impact on water quality resulting from dairy wastewater in a manner that will be acceptable to the public and the farmer. The national trend is towards increased governmental regulation. The results of this research will address the problem of dairy wastewater remediation in advance of the development of new regulations that might produce insurmountable financial barriers to farmers.

Effects of freezing conditions and soil moisture on herbaceous perennial hardiness.

Investigators: Perry, L.

Performing Department: Plant & Soil Science -- 1825

Start Date: 10/01/1999 Termination Date: 09/30/2002
Reporting period: 10/01/1999 to 09/30/2002
Report was submitted to CRIS on 04/08/2003

Termination Report:
Four studies were conducted to compare the effects of various freezing methods on the hardiness of containerized herbaceous perennials. Four to eight weeks after controlled freezing plant hardiness was evaluated based on a visual rating scale, number of flowering stems, shoot height and width and dry weight. In the first study length of the acclimation period at -2C and duration of freezing at subzero temperatures were examined. For Dianthus deltoides `Vampire' and Geranium x cantabrigiense `Cambridge' significantly lower regrowth was observed on those plants subjected to 7 days of acclimation at -2C. Regrowth and survival was also significantly lower for those plants held at subzero treatment temperatures for 24 hours. A second study compared the hardiness of established, one year old plants that had been used in previous freezing studies with new plants that had been transplanted from plugs ten weeks prior to freezing. For established and new plants of Tiarella cordifolia `Brandywine', T. wherryi `Martha Oliver' and Geranium x cantabrigiense `St Ola', significantly more regrowth as new plants than as established plants was seen for Tiarella. However, Geranium plants that had been established were more successful than those that were newly potted. Thawing rates after periods of controlled freezing were examined in two separate studies. Rapid thawing is the transfer of plants from a subzero treatment temperature (-5, -8, -11, -14C) directly to 3C conditions. Slow thawing is the slow increase of the freezer temperature to the acclimation temperature of -2C at the controlled rate of 2C/h before transfer of plants to 3C conditions. In the first study, Geranium `Cambridge' plants exposed to rapid thawing displayed higher rates of regrowth and survival than those subjected to slow thawing due to the prolonged freezing duration of slow thawing. In the second thawing rate study, the process was repeated with Geranium `St Ola' and `Karmina' and Tiarella `Brandywine' and `Martha Oliver' except that in the slow thawing treatment plants were held at -2C for 2 hours rather than 24 hours. Tiarella exposed to rapid thawing experienced higher rates of regrowth and survival than those exposed to slow thawing, while the opposite was true for Geranium `Karmina'. The influence of temperature cycling prior to controlled freezing was studied on Dianthus `Vampire' and Geranium `Cambridge'. Temperatures cycled between either -3 and +3C or -8 and +8C and plants were held at each temperature for 24 or 72 hours as temperatures were lowered, raised and lowered again before freezing at treatment temperatures. The range of temperature fluctuation is the determining factor on plant hardiness. Plants that cycled between -3/+3C for 24 and 72h displayed significantly higher regrowth and survival than all other treatment groups. Plants that cycled between -8/+8C for either 24 or 72h exhibited significantly lower regrowth than all other groups.

Publications:
Bruce, Cheryl. 2003. The effects of freezing and thawing conditions on cold hardiness of containerized herbaceous perennials. M.S. thesis, Univ. Vt.

Impact:
Growers can more successfully overwinter perennials, especially these popular genera, or know better what to expect from similar conditions.

Management of Tarnished Plant Bug with Entomopathogenic Fungi: Phase II.

Investigators: Parker, B. L., Skinner, M., Brownbridge, M.

Performing Department: Plant & Soil Science -- 1825

Start Date: 10/01/1999 Termination Date: 09/30/2002
Reporting period: 10/01/1999 to 09/30/2002
Report was submitted to CRIS on 04/08/2003

Termination Report:
Research was done to 1) develop standardized mass production techniques for fungi virulent to tarnished plant bug (TPB), 2) compare the efficacy of formulated and non-formulated fungi against TPB, and 3) evaluate the efficacy of fungi in greenhouse and field trials. In phase 1 of this project we identified several fungal isolates that were highly virulent against TPB, particularly B. bassiana (ARSEF 1394) and M. anisopliae (ARSEF 3540). In the current study we evaluated factors related to development and tested selected strains under field conditions. Isolates were produced on millet or corn as a solid substrate or on standard agar-based medium (SDA). The relative costs of materials to produce 1 g of conidia (~1 x 10e10) on SDA, millet and corn were $3.00, 0.02 and 0.003 per g respectively. Labor requirements were also substantially reduced (<75%) when using grain for mass production. When the basal substrate (corn) was augmented with dextrose and/or brewers yeast there was no significant effect on spore production by B. bassiana, nor on the viability of the spores produced. Conidia formulated with Fertogel (Milwhite Inc., Texas) as wettable powder (WP) or in Horticultural Oil (Bonide Products Inc., NY) as emulsifiable suspension (ES) were equally effective under laboratory conditions, but there were differences in fungal efficacy depending on method of inoculation (residual or direct contact) and the insect life stage treated. The highest infection rates of adults were obtained when they were contacted directly with the spray inoculum, whereas with immatures higher infection rates occurred with insects released onto previously sprayed leaves (residual contact). Neither formulation base caused phytotoxicity to Romaine lettuce under field conditions. A leaf damage rating system, used post harvest to assess TPB induced damage, was devised with grower input; the relative variation of the results was <10 %. Field trials on Romaine lettuce were conducted during spring 2001 and both spring and summer 2002 using Mycotrol O (Mycotech) (2001), the two TPB active isolates, formulated as either WP or ES (2002), and the insecticide Sevin-XLR Plus as a chemical standard. During 2001, plant damaged was reduced in plots treated with Sevin and B. bassiana, but the differences were not statistically significant from untreated plots. In the spring 2002 trial, TPB control was poor in plots treated with the fungi compared to the plots treated with Sevin, possibly due to hot dry conditions. Migration of insects into and between plots may have confounded the results, even though plots and buffers sizes were expanded in 2002 to limit inter-plot movement of TPB. In the second 2002 trial, cooler, wetter conditions promoted fungal infection and better control was obtained. Both experimental isolates performed well in greenhouse trials; we suspect that relatively poor TPB control in the field occurred because insects were primarily in the leaf whorl at the time of spraying and thus were not directly contacted. Better methods of targeting the insects need to be devised to obtain the desired level of control.

Publications:
Liu, H., Skinner, M., Parker, B.L. and Brownbridge, M. 2002. Pathogenicity of Beauveria bassiana, Metarhizium anisopliae(Deuteromycotina: Hypomycetes), and other entomopathogenic fungi against Lygus lineolaris (Hemiptera: Miridae). J. Econ. Entomol. 95: 675-681.

Liu, H., Skinner, M. Brownbridge, M. and Parker, B.L. 2003. Characterization of Beauveria bassiana and Metarhizium anisopliae isolates for management of tarnished plant bug, Lygus lineolaris (Hemiptera: Miridae). J. Invertebr. Pathol. (in press).

Liu, H., Parker, B.L. Skinner, M. and Day, W.H. 2003. Guide to damage by tarnished plant bug on vegetables, herbs and fruit. USDA. (in press).

Impact:
The techniques developed for mass production of fungi allow large quantities of spores to be inexpensively produced for small scale field-testing. The relationship between spore acquisition, formulation and insect developmental stage provide insight into management strategies for TPB and other insects. The methodology developed for assessing damage to romaine lettuce will support future research in this area.

Managing parasites of pastured livestock on organic farms.

Investigators: Murphy, W.

Performing Department: Plant & Soil Science -- 1825

Start Date: 10/01/1999 Termination Date: 09/30/2002
Reporting period: 10/01/1999 to 09/30/2002
Report was submitted to CRIS on 04/08/2003

Termination Report:
Organic farmers must manage pests using practices that meet organic certification rules. Well-managed pasture provides excellent organic feed, but internal parasites can cause losses in young animals, unless kept at tolerable levels. We evaluated the efficacy of herbal and fungal materials and grazing management that may be used to reduce parasitism of pastured livestock on organic farms. None of the materials affected worm egg levels in treated animals. Grazing management, however, did reduce parasitism. On pasture that was not grazed by adults of the same species in the current year, grazing young animals with adults (eg. lambs with ewes) on each pasture area only once per season maintained low, tolerable levels of parasites in young animals.

Publications:
Webb, T. 2001. Managing parasites of grazing livestock on organic farms. University of Vermont. Master of Science thesis. December. 46 pp.

T. Webb, R. Shepherd, H. Forgues, T. Forgues, K. Doolan,G. van Vlaanderen, G. Myers, J. Knapp, and W. Murphy. 2003. Grazing strategies for managing internal parasites of pastured livestock. Submitted to American Journal of Alternative Agriculture.

Impact:
Appropriate grazing management could help organic farmers reduce losses due to parasitism, thereby increasing farm profitability.

Multidisciplinary evaluation of new apple cultivars and rootstocks.

Investigators: Garcia, M. E., Berkett, L. P.

Performing Department: Plant & Soil Science -- 1825

Start Date: 10/10/1999 Termination Date: 09/30/2001
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
The selection of cultivars and rootstocks that are adapted to Vermont's climate and pest conditions and which will produce high quality fruit from high yield efficiency trees is a crucial decision for an apple grower since this decision will impact the farm's competitiveness, profitability, and sustainability for many years. The 1999 NE-183 Horticulture Plantings at the University of Vermont Horticultural Research Center in So. Burlington, VT is maintained according to protocol established by the Horticulture Sub-committee at the 1999 and 2000 Annual Meetings. Although flower density for most cultivars was adequate to set a good crop, the weather conditions during bloom resulted in many cultivars having a reduced crop or no crop. This created difficulty in data collection, evaluation, and analysis due to incomplete data sets.

Publications:
(No publications.)

Impact:
Multidisciplinary evaluation of new apple cultivars will provide critical information to help the North American apple growers compete in a rapidly changing global fruit market. This was the second year the 1999 planting produced fruit, but because of the weather conditions during bloom, the yield and horticultural data collected this year may be of limited value. However, results from the fruit that was tested indicate that the cultivars `Pinova' and `Zesta!' have horticultural and fruit qualities that may make them acceptable to Vermont apple growers.

NORTHEAST REGION SUSTAINABLE AGRICULTURE RESEARCH AND EDUCATION PROGRAM

Investigators: Magdoff, F. R.

Performing Department: Plant & Soil Science -- 1825

Start Date: 04/01/1998 Termination Date: 03/31/2003
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
Administer USDA SARE Program for the Northeast Region Coordination of the USDA Sustainable Agriculture Research and Education Program for the 12 States in the Northeast Region. Send out calls for proposals, assemble Committees to review proposals and provide guidance. Publish newsletter, INNOVATIONS, and produce other materials for distribution. Oversee contracts with various recipients.

Publications:
INNOVATIONS.2002. Northeast SARE newsletter issued quarterly.

Impact:
Will help change farming practices to those that are more environmentally , economically, and socially sound.

Soil and Site Characteristics Influencing Phosphorus Loss to Runoff

Investigators: Magdoff, F. R., Jokela, W. E., Aleong, J.

Performing Department: Plant & Soil Science -- 1825

Start Date: 10/01/2000 Termination Date: 09/30/2003
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
During the past year we set up the rainfall simulator on 5 field sites, extending the range of soil types studied to include silt loam-fine sandy loam soils as well as clays. Due to some heavy rain events during our field runs, we were able to collect runoff from natural rainfall to compare with runoff from simulated rainfall (which uses well water). The results confirm lab data showing that distilled water (and rainwater) extract about twice as much P as well water. We also used the rainfall simulator in several replicated experiments using soil packed in metal pans ("runoff boxes"). Dissolved P concentrations in runoff from the pans were similar to those from field plots, but suspended solids were 2 to 10 times greater from the boxes than from field plots, making it difficult to estimate likely total P loss from runoff box experiments. In the lab, we evaluated techniques for analyzing bio-available P (iron oxide strip method) in soil and runoff, and water-extractable P in manure.

Publications:
Tilley,J.P., Jokela, W., Magdoff, F., Stewart, E. Runoff and Soil Test Phosphorus from Crop Fields in Vermont. 2002. American Society of Agronomy National Meeting Abstracts.

Anderson, B.H., Magdoff, F. 2002. Movement and Characterization of Soluble Organic Phosphorus in Manure Amended Soils. American Society of Agronomy National Meeting Abstracts.

Anderson, B.H., Magdoff, F. 2002. Should Sediment Samples Be Autoclaved Prior to Algal Assays? American Society of Agronomy National Meeting Abstracts.

Impact:
Help farmers to better manage phosphorus, thus decreasing environmental damage to lakes.

Optimization of Irrigation Effeciency in the Vermont Vegetable Industry

Investigators: Tignor, M.

Performing Department: Plant & Soil Science -- 1825

Start Date: 10/01/2000 Termination Date: 09/30/2003
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
We examined the use of dairy manure compost (DMC) as a nutrient substitute, replacing additional fertilizer inputs using three nutrition programs to test quality yield responses in potato (Solanum tuberosum L.) Nutrition programs tested were: 1) `liquid N,' receiving only additional fertilizer inputs and no compost; 2) `combination' receiving 20 tons/acre DMC and half the rate of supplemental fertilization as `liquid N,' and 3) `compost,' receiving 40 tons/acre of DMC. The `compost' nutrition program yielded a similar amount of potatoes when compared to the other nutrition programs indicating the potential for compost to replace supplemental fertilizers in specific situations. Increase in amendment of DMC reduced the total amount of irrigation necessary to maintain 65% plant available water. The study also showed significantly different yields between cultivars tested. `Butte Russet' had a greater marketable yield than `Russet Burbank' when compost was amended at a rate of 40 tons/acre. This study was replicated in time during two growing seasons. Additionally, a variety trial was conducted on heirloom tomato varieties. Yield and quality of eleven different heirloom varieties (Lycopersicon esculentum Mill.) were compared to a garden hybrid tomato `Better Boy.' `Amish Paste', `Brandywine', `Cherokee Purple', `Costoluto Genovese', `Cosmonaut Volkov', `Green Zebra', `Ida Gold', `Moskvich', `Purple Calabash', `Pruden's Purple', and `Yellow Brandywine' varieties were produced using black plastic, drip irrigation, and fertigation during two successive growing seasons. Year and variety had significant impacts on yield. When US#1 and US#2 grades were combined `Ida Gold', `Amish Paste', `Moskvich', `Cosmonaut Volkov', `Green Zebra', and `Better Boy' had significantly greater marketable yields than `Purple Calabash', `Pruden's Purple', `Cherokee Purple', `Yellow Brandywine', and `Brandywine'.

Publications:
Sands, N.H., D.A. Heleba, and M.E. Tignor. 2002. Effect of a single addition of compost on potato yields when nitrogen and plant available water are not limiting. Proceeding of the XXVI International Horticultural Congress. p.105 (Abstract).

Sands, N.H., D.A. Heleba, and M.E. Tignor. 2002. Marketable yield evaluation of eleven heirloom tomato varieties. Proceeding of the XXVI International Horticultural Congress. p.535-536 (Abstract).

Impact:
Vermont vegetable production is a small (about 3300 acres), but highly diverse (over 300 farms) horticultural industry. The results of the work to date will help Vermont farmers make better varietal selections, improve irrigation efficiency, and better utilize local nutrient resources.

Soil Manganese Oxides: Oxidation and Retention of Contaminant Metals and Organics

Investigators: Ross, D. S.

Performing Department: Plant & Soil Science -- 1825

Start Date: 10/01/2000 Termination Date: 09/30/2002
Reporting period: 10/01/2000 to 09/30/2002
Report was submitted to CRIS on 04/08/2003

Termination Report:
Soil manganese oxides may control the behavior of many contaminant metals through sorption and, in some cases, oxidation. We studied the behavior of these oxides in medium to high-Mn soils from Vermont's Champlain Valley using x-ray absorption spectroscopy and the Cr Oxidation Test. The soils studied had a wide range in total Mn (0.04 to 1.75%), Cr Oxidation Test (0.03 to 4.9 mmol Cr(VI) per kg soil), pH (4.6 to 7.2) and organic carbon (3 to 27%). X-ray fluorescence (XRF) mapping showed that the Mn oxides were concentrated in discrete accumulations that were usually between 0.05 and 0.10 mm in diameter. These accumulations were distributed evenly through the soil matrix. Two heavy metals studied, lead and cobalt, were strongly associated with the Mn oxides, both in metal-treated and untreated samples. Manganese Ka x-ray absorption near edge structure (XANES) spectroscopy of both moist and recently air-dried soil samples showed spectra similar to that of birnessite (and other 'higher' oxides). The energy position of the main edge varied over a fairly narrow range of 1.5 eV but there was a clear linear shift toward higher energy with higher soil pH. After extended incubation of low-pH soil samples treated with increasing levels of base, XANES spectra showed an upward shift in the energy of the main edge. Low base additions and modest pH increase (~ 1.0 to 1.5 pH units) resulted in increases in the Cr oxidation test but higher base resulted in decreases. Competitive adsorption studies showed differences in the interference of added Pb and Co on the Cr oxidation test. These differences are consistent with two types of adsorption sites, one of which facilitates the oxidation of the sorbed metal, e.g. Co(II) to Co(III). Although synchrotron radiation may cause Mn oxide reduction, oxidation of added Mn(II) was also observed with this technique. This oxidation of Mn(II) after exposure to the x-ray beam suggests an abiotic mechanism. Sample drying resulted in slow reduction of the Mn oxide but a faster reduction in the Cr oxidation test. Alteration in surface reactivity was the initial response. These experiments confirm the dynamic nature of soil Mn oxides.

Publications:
(No publications.)

Impact:
The strong affinity of soil Mn oxides for lead and cobalt was confirmed. At least two types of adsorption sites appear to exist. Soil Mn oxides are sensitive to environmental changes. Although they are sinks for these heavy metals, the long-term stability of the oxide-metal interaction is not yet known.

Improved propagation and culture of ericaceous plants for Vermont landscapes

Investigators: Starrett, M. C.

Performing Department: Plant & Soil Science -- 1825

Start Date: 10/01/2000 Termination Date: 09/30/2003
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
Studies were conducted to examine the host range of a select isolate of the ericoid mycorrhizal fungus, Hymenoscyphus ericae. Host status was tested for fifteen ericaceous species including: Calluna vulgaris, Enkianthus campanulatus, Gaultheria procumbens, Kalmia latifolia, Leucothoe fontanesiana, Oxydendrum arboreum, Pieris floribunda, Rhododendron calendulaceum, Rhododendron carolinianum, Rhododendron catawbiense, Rhododendron maximum, Rhododendron mucronulatum, Vaccinium corymbosum and Vaccinium macrocarpon. All of the species were colonized by the ericoid isolate with the exception of Enkianthus campanulatus. Inoculation with this isolate of H. ericae resulted in a significant increase in shoot growth. However, intensity of root colonization was not correlated to amount of shoot growth. In another experiment, inoculation of microshoots of Rhododendron 'Elviira', R. 'Ginny Gee' and R. 'Nova Zembla' with an isolate of the ericoid mycorrhizal fungus Hymenoscyphus ericae did not improve initial rooting or survival after one month incubation in a growth chamber when compared to non-inoculated microshoots. Additionally, no survival or shoot growth benefits were apparent from mycorrhizal inoculation of plantlets after 3 months in a greenhouse. Although the cultivar selections, R. 'Elviira' and R. 'Ginny Gee' are purportedly difficult to root and establish, >90% of all plantlets survived and acclimatized to greenhouse conditions regardless of treatment. Therefore, addition of an ericoid mycorrhizal fungus to a rooting mix does not help the plants during propagation and therefore is not necessary. Another experiment investigated the presence of ericoid mycorrhizal fungi in select peat and peat-based products. Results indicate that these fungi are present in the majority of the media tested. Seedlings grown in some of the selected media had a greater percentage of root cells colonized by ericoid mycorrhizae than others in the study. This means that growers of ericacous crops such as rhododndrons and blueberries who start their plants in a peat-based potting mix will not need to inoculate their plants with an ericoid mycorrhizal fungus, thus saving time and expense. The heather hardiness trials are still on-going. this winter's extreme cold conditions will prove very useful in determining which selection of heather is the most hardy for use in landscapes in Vermont.

Publications:
Gorman, N.R. and M.C. Starrett. 2003. Screening commercial peat and peat-based products for the presence of ericoid mycorrhizae. Journal of Environmental Horticulture. (In press)

Starrett, M.C. 2003. Use of an ericoid mycorrhizal fungus to improve rooting and acclimatization of difficult-to-root microshoots of select cultivars of Rhododendron. Journal of the American Rhododendron Society. (In press)

Starrett, M.C. 2003. Initial Shoot Growth and Development of Micropropagated Blueberry Plants Following Inoculation with an Ericoid Mycorrhizal Isolate. Acta Horticulturae. International Society for Horticultural Science. (In press)

Gorman, N.R. and M.C. Starrett. 2003. Host range of a select isolate of the ericoid mycorrhizal fungus, Hymenoscyphus ericae. HortScience. (In press)

Impact:
Identification of specific cultivars of heather which prove to be the most cold-hardy in our trials will provide information to residents of Vermont and other states in New England who desire to grow these colorful groundcover/low shrub plants. Additionally, the technique of covering the plants with pinestraw may aid in improving the overwintering ability of certain cultivars that might be marginally cold-hardy in this climate. Determining if inoculation with an ericoid mycorrhizal fungus can improve rooting, survival and growth of difficult-to-root cultivar selections of rhododendrons is helpful information to those propagators producing these valuable plants suitable for use in New England. Determining which strain of ericoid mycorrhizal fungi is best in promoting growth of highbush blueberries or rhododendrons or other ericaceous plants is important to growers who may wish to inoculate their plants during propagation and production cycles.

Mycotoxins produced by acid tolerant Pencillia and their affect on rumen digestion.

Investigators: Gotlieb, A. B., Currier, W.

Performing Department: Plant & Soil Science -- 1825

Start Date: 10/01/2000 Termination Date: 09/30/2003
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
Acid tolerant species of Penicillium obtained from bunker silos were tested in the lab for toxin production. Isolates producing roquefortine were selected and grown on corn meal media and extracted. Experiments were run to determine best culture conditions for development of fungal growth and toxin development. Isolates were identified down to species. Rumen fluid was challenged invitro to determine if the fungal extracts could reduce digestion. Experiments indicate digestion can be reduced by more than 50% as compared to the control. Additional research is needed to support these early findings.

Publications:
(No publications.)

Impact:
This work may lead to control of toxin producing fungi in corn silage that reduce milk production.

Predicting Quality of Alfalfa, Grass and Mixed Stands Grown for Hay and Silage

Investigators: Bosworth, S., Aleong, J.

Performing Department: Plant & Soil Science -- 1825

Start Date: 10/01/2000 Termination Date: 09/30/2003
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
Forage quality is an important factor in dairy profitability. One of the most important factors affecting quality is timing of harvest; yet, most harvest management decisions are made with little or no information on quality of the forage in question. The purpose of this research is to develop an affordable, practical and reliable method for predicting forage quality of the first harvest that can be used as a management tool by dairy producers in Vermont. In 2002, the second year of the project, data was collected from two experimental sites and four farm field sites. At the experimental sites, eight subplots were randomly located within each plot and forage samples were collected once per week during the spring growth period starting when the earliest grass cultivar showed evidence of stem elongation until the last cultivar was in early head stage (5/1 to 6/14). Data collected included mean stage by count (MSC) and weight (MSW), acid detergent fiber (ADF) neutral detergent fiber (NDF), in vitro true digestibility (selected treatments), aerial and soil temperature, and precipitation. In preliminary results of three of the six grass cultivars in the study, ('Pizza' and 'Baridana' orchardgrass and 'Palaton' reed canarygrass), we found significant linear relationships between forage quality (ADF and NDF) with date, accumulated growing degree days (base 5C), MSC and MSW. The most consistent linear relationship (with the highest r values) amongst cultivars and location was with ADF and accumulated GDD. On the average, ADF increased 0.036 percentage units for every accumulated GDD (base 5C). Changes in NDF by GDD were less consistent amongst cultivars and between locations. Four farm fields of alfalfa were evaluated for testing a relationship of changes in ADF and NDF with GDD and morphological/height measurements as prescribed by the Prediction Equation of Alfalfa Quality (PEAQ). Five to eight subsites were randomly chosen in each field and sampled twice, 1) early May when alfalfa was in a prebud stage and 2) late May on the day before the field was being harvested. PEAQ measurements were made at both sampling dates and GDD accumulation was determined during the interim period. Preliminary results showed a good relationship between GDD and changes in ADF and NDF but there was variation in across locations. PEAQ was not a good predictor when alfalfa was in the pre-bud stage. For the up coming spring (2003), we will repeat our measurements at the same two experimental sites. Farm field evaluations will be increased to include grasses and alfalfa grass mixtures.

Publications:
(No publications.)

Impact:
Data collected from these trials will be used in developing a forage quality prediction model for the first harvest of cool season grasses and alfalfa. This will enable the University of Vermont Extension in collaboration with the UVM Forage Testing Laboratory to develop a more effective forage quality and dairy profitability program. Improved forage quality will result in higher dairy income, which has positive impacts on rural communities and infrastructure.

Impact of Beneficial Microbes and Insect-Resistant Transgenic Corn on Non-Target Soil Microarthropods

Investigators: Brownbridge, M., Soto-Adames, F., Harper, W. S., Altemose, C.

Performing Department: Plant & Soil Science -- 1825

Start Date: 10/01/2001 Termination Date: 09/30/2004
Reporting period: 10/01/2001 to 09/30/2004
Report was submitted to CRIS on 04/08/2003

Termination Report:
Integration of biologically-based pest management techniques into crop production systems is critical to the long-term well-being of US agriculture. This includes the broader use of biopesticides and transgenic crops. To ensure that there is minimal impact on non-target beneficial soil fauna, we must proactively evaluate effects of these microbial control agents and toxins expressed by genetically-modified plants on key indicator species. Collembola play a vital role in the removal, breakdown and re-cycling of crop residues, and are abundant in healthy and productive soils. Through laboratory and field tests on these organisms, we can identify potential side-effects of these control tactics. Three commercial products based on Bacillus thuringiensis (Dipel, Xentari and MVP II) have been tested in feeding assays against Folsomia candida. Even administered at four times the recommended field-use rate, no negative effects were detected on egg production and longevity. In standardized soil assays, population development of the collembolan was similar (no statistically significant differences) in all treatments, i.e., Bt-treated vs. non-treated soil. Field trials were initiated in June 2002, using plots planted with Bt-transgenic and isogenic (parent line) silage corn. Soil samples have been taken at monthly intervals in the root zone of the corn plants (June thru' Dec) and subject to extraction using Berlese funnels. Collembola recovered from the soils are currently being identified. Results will reveal if there are differences in species abundance and diversity according to the crop regimen. Trials will be repeated in 2003 and 2004. The stability of the Bt toxin during composting is also being evaluated. This research will be continued on the S-301 Multistate project, VT-PS-00921.

Publications:
Brownbridge, M., H. Kato, and M. Broza. 2002. Assessing non-target effects of Bacillus thuringiensis and neem using Folsomia candida (Collembola), p. 72. In: Abstracts, 8th International Colloquium on Invertebrate Pathology and Microbial Control, Aug. 18-23, Foz Do Iguassu, Brazil.

Impact:
Results will allow us to begin to quantify ecological impacts of microbial control agents and GMOs on a scientific basis. In this way we can define future research and development needs in this area.

Research advances in agricultural statistics

Investigators: Aleong, J.

Performing Department: Plant & Soil Science -- 1825

Start Date: 10/01/2001 Termination Date: 09/30/2004
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
1.Participated in spatial workshop on spatial analysis for designed experiments at the NCR-170 Meeting, July 11-12, 2002, at the University of Maryland, College Park. 2. Developed a new method to compare correlated growth rates for longitudinal data.

Publications:
Aleong, C and Aleong, J. 2002. Comparisons of Compound Growth Rates in Longitudinal Data: Mixed Models in Finance and Management, 2002 Proceedings of the American Statistical Association, Business & Economic Statistics Section [CD-ROM], Alexandria, VA: American Statistical Association.

Aleong, C and Aleong, J. 2002. Comparisons of Compound Growth Rates in Longitudinal Data: Mixed Models in Finance and Management, Abstract, Joint Statistical Meetings, New York, August 2002, pg. 53.

Impact:
The methods will help researchers to correctly design and analyze studies with correlated data at low cost.

ROOTSTOCK AND INTERSTEM EFFECTS ON POME AND STONE FRUIT TREES

Investigators: Garcia, M. E., Berkett, L. P.

Performing Department: Plant & Soil Science -- 1825

Start Date: 10/01/2001 Termination Date: 09/30/2002
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
Tree maintenance and data collection for the 1999 planting of the NC-140 Cornell/Geneva Apple Rootstock Evaluation continues at the University of Vermont Horticultural Research Center in So. Burlington, VT. The trees were trained, pruned and maintained according to protocol developed by the Principal Leaders. Despite the poor weather conditions during pollination, this block performed well.

Publications:
Garcia M. E., C. R. Rom, and J. B. Murphy Comparison of phenolic content of Liberty apple (Malus x domestica) on various rootstocks. Poster Presentation. First International Symposium on rootstocks for deciduous fruit tree species. June 2002. Zaragoza, Spain. Proc. Pg.P1-2

Impact:
The selection of rootstocks that are adapted to our Vermont's climate and pest conditions and which will produce high quality fruit along with high yield that will compete successfully in the market place is a crucial decision for apple growers since the cost to establish or replant one acre of apples is estimated to be $17000. The data indicate that the CG series outperforms the EMLA series in precocity and yield. CG16N had a large crop load with large apples. Cultural practices and data collection will continue under the direction of the Principal Leaders.

Northeast Region Sustainable Agriculture Research & Education Program

Investigators: Magdoff, F. R.

Performing Department: Plant & Soil Science -- 1825

Start Date: 02/01/2001 Termination Date: 01/31/2006
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
Will help change farming practices to those that are more environmentally , economically, and socially sound. Administer USDA SARE Program for the Northeast Region Coordination of the USDA Sustainable Agriculture Research and Education Program for the 12 States in the Northeast Region. The Professional Development Program is part of SARE and works to enhance knowledge and abilities of professionals working with farmers in the area of sustainable agriculture. Send out calls for proposals, assemble Committees to review proposals and provide guidance. Publish newsletter, INNOVATIONS, and produce other materials for distribution. Oversee contracts with various recipients.

Publications:
INNOVATIONS.2002. Northeast SARE newsletter published quarterly.

Impact:
Extension educators and others working directly with farmers will have enhanced knowledge and capabilities in the area of sustainable agriculture.

Profiling Entomopathogenic Fungi in UVM's Worldwide Collection

Investigators: Parker, B. L., Skinner, M., Brownbridge, M.

Performing Department: Plant & Soil Science -- 1825

Start Date: 10/01/2002 Termination Date: 09/30/2005
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
As we strive to implement more sustainable and ecologically-acceptable methods of crop protection, we must continue to develop effective biological control methods as important components of these new strategies. Insect-killing fungi are an under utilized resource that warrant further research for their development as reliable tools for IPM. The best candidate strains must possess several key traits, including an ability to infect and kill a target pest over a range of environmental conditions, and to consistently produce large numbers of infective spores in artificial culture. We will quantify key characteristics of a representative sample of the isolates in UVM's Fungal Collection, which contains entomopathogens collected from a diverse range of geographic and environmental locations around the globe, to establish their potential for utilization in integrated crop protection strategies. To ensure the long-term viability and accessibility of this collection, the first step in this project has been to place all of the isolates in permanent low-temperature storage, and establish a comprehensive data base which includes date and location of collection, original host, collector and identifier, and other pertinent information. To date, we have processed >300 isolates into cold storage, and hope to have the entire collection preserved before the end of 2003.

Publications:
(No publications.)

Impact:
When this project has been completed, we will have characterized approximately one-third of the >1,200 isolates currently held in our collection. This is one of the largest such undertakings, and will produce a unique data set on the relative virulence and performance of entomopathogenic fungi from diverse hosts and geographic locations. Scientifically, this will be invaluable, but it will also allow us to identify strains which show the highest potential for further exploitation in insect pest management.

Plant age, acclimation, and freezing effects on herbaceous perennial hardiness

Investigators: Perry, L.

Performing Department: Plant & Soil Science -- 1825

Start Date: 10/01/2002 Termination Date: 09/30/2005
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
The first experiments on this new project were initiated this winter 2002-2003. On plant age and acclimation, Dianthus 'Vampire' and Geranium 'Cambridge' were brought inside the UVM greenhouse from the outdoor nursery area on Oct. 18, Nov. 1 and Nov. 15. Established plants, divisions or plugs were in 4-inch pots. Plants were subsequently frozen to -2,-5,-8,-11 or -14C, placed back in the 4C greenhouse and will be rated for survival and regrowth as well as dry weights. To examine the effect of cycling temperatures between -3 and +3C, then subsequent freezing as above, two cultivars of Geranium--'Karmina' and 'Dilys'-- were used, and Iris sibirica 'Pirate Prince'. Data will be gathered as above. For freezing to temperatures as above, and no prior variables, nine cultivars of various perennials were used including two Phlox paniculata, two monarda, three heather, a sedum and a Leucanthemum. Data will be gathered as above.

Publications:
(No publications.)

Impact:
Growers will be better able to predict freezing impacts on perennials, and to provide protection as appropriate.

Northeast Region Sustainable Agriculture Research & Education Program

Investigators: Magdoff, F. R.

Performing Department: Plant & Soil Science -- 1825

Start Date: 03/15/2002 Termination Date: 03/14/2007
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
Administer USDA SARE Program for the Northeast Region Coordination of the USDA Sustainable Agriculture Research and Education Program for the 12 States in the Northeast Region. The Professional Development Program is part of SARE and works to enhance knowledge and abilities of professionals working with farmers in the area of sustainable agriculture. Send out calls for proposals, assemble Committees to review proposals and provide guidance. Publish newsletter, INNOVATIONS, and produce other materials for distribution. Oversee contracts with various recipients.

Publications:
INNOVATIONS. 2002. Northeast SARE newsletter published quarterly.

Impact:
Extension educators and others working directly with farmers will have enhanced knowledge and capabilities in the area of sustainable agriculture.

IMPROVED GREENHOUSE TECHNOLOGIES SUPPORTING NEW ENGLAND FAMILY FARMS

Investigators: Brownbridge, M., Skinner, M.

Performing Department: Plant & Soil Science -- 1825

Start Date: 02/15/1998 Termination Date: 02/28/2002
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
Today, there are mounting pressures to reduce pesticide use in the floral industry. As most of the active ingredient in a pesticide spray never actually reaches the target pest, considerable reductions in waste and environmental contamination can be achieved by improving pesticide application systems. This would also increase cost-effectiveness, efficacy, and applicator safety. Optimization of spray protocols for biological pesticides such as entomopathogenic fungi is especially important for them to work efficiently, and to maximize contact between the pest and the active ingredient, i.e., fungal spores. In our trials, we have sought to optimize spray parameters for application of Beauveria bassiana (BotaniGard) for control of thrips. Using a custom-designed spray rig on chrysanthemums, we found that nozzle size is critical: those delivering high volumes (e.g., SFC-10) were inefficient and wasteful; too fine a spray limited spore deposition on the underside of leaves. Use of an appropriate nozzle and spray pressure to moved the leaf canopy enhanced deposition, and the best coverage was obtained by spraying down both sides of a row; this method requires more material and time, though, so may not be economical or practical. Using parameters that provided good coverage on chrysanthemums, tests were repeated on New Guinea impatiens. Good coverage of foliage was achieved with both SFC-1 and FF-8004 nozzles at either 0 or 30 degree spray angles. Flowers were also well covered, an important consideration as thrips congregate in and around impatiens blooms. We then tested a standard high-pressure hydraulic sprayer (Dramm MSO @ 150 psi) and an electrostatic sprayer (Ess, Inc.), treating multiple rows of plants at different spray speeds. With both sprayers, slower passage past plants (39 vs. 59 ft/min), coupled with treatment from both sides increased spore deposition and penetration. Fewer spores were deposited by the electrostatic sprayer than the hydraulic sprayer. These data confirmed earlier findings where better suppression of thrips on chrysanthemum and whitefly on poinsettia was obtained using the hydraulic sprayer - a function of higher spore deposition - suggesting the greater utility of this type of sprayer for application of fungal materials. Our final goal is to assess whether, by adopting these `best spray practices', we can improve spore deposition when sprays are made by a pesticide applicator.

Publications:
(No publications.)

Impact:
This research will enable us to define efficient spray practices (methods, equipment and products) that lead to improved targeting of pests with fungal biopesticides, enhancing efficacy and cost-effectiveness, thereby promoting greater use of these biocontrols in IPM.

ASSESSING THE ENVIRONMENTAL IMPACT OF BIOPESTICIDES USING COLLEMBOLA

Investigators: Brownbridge, M.

Performing Department: Plant & Soil Science -- 1825

Start Date: 10/01/1998 Termination Date: 09/30/1999
Reporting period: 10/01/1998 to 09/30/1999
Report was submitted to CRIS on 04/08/2003

Termination Report:
As we strive to reduce chemical inputs in all sectors of agriculture and promote the use of microbial and biorational pesticides, the impact of large-scale applications on the soil ecosystem must be considered. Collembola are abundant in robust and productive soils, and play a vital role in the removal and breakdown of microbes and crop residues. The purpose of the current project, therefore, was to evaluate acute and chronic side-effects of selected Bacillus thuringiensis (Bt) products and the botanical insecticide neem on Folsomia candida. Three Bt products, Xentari (aizawai), Dipel (kurstaki) and MVP II (contains 20% Cry1Ac Bt protoxin expressed by and encapsulated in Pseudomonas fluorescens) were presented to mature F. candida using a novel feeding assay. The Collembola were fed on treated diet exclusively for 4 weeks, and were then fed on a yeast-agar diet for an additional 4 weeks. An aqueous neem seed extract was also prepared and administered using the same methodology. Effects on longevity and fecundity were monitored over the 8 week test period. Administered at 0.5 - 4 times the recommended field application rate, none of the Bt products affected egg production and longevity, compared with the non-treated controls. In contrast, egg production was significantly impaired in populations presented with the neem-contaminated diet after only 2 weeks exposure; egg production ceased altogether by week 4. Effects were sustained even when the insects were fed on the yeast-agar diet. Fewer Collembola survived the neem treatments than the untreated control. To determine whether effects were due to starvation, as a result of neem's repellent effects which could prevent feeding, or from neem's effects on collembolan physiology, batches of individuals were fed a on neem-treated diet, or were starved for an equivalent amount of time. Mortality was higher in all neem-treated batches, and egg production ceased by week 4. Conversely, while starved individuals laid fewer eggs, production resumed when they they were allowed to feed freely again.

Publications:
Brownbridge, M. Kato, H. and Broza, M. Assessing non-target effects of Bacillus thuringiensis and neem using Folsomia candida (Collembola), pp. 72. In, Proceedings, 8th International Colloquium on Invertebrate Pathology and Microbial Control, Aug. 18-22, 2002, Foz do Iguassu, Brazil.

Impact:
Although data cannot be directly extrapolated to predict effects under field conditions, these assays allow us to begin to quantify potential ecological impacts of microbial control agents and botanical insecticides in a rapid and reproducible manner.

Microbial and Physico-chemical Control of Nitrogen Mobility in Forest Ecosystems

Investigators: Ross, D. S., Lini, A.

Performing Department: Plant & Soil Science -- 1825

Start Date: 10/01/1999 Termination Date: 07/31/2002
Reporting period: 10/01/1999 to 07/31/2002
Report was submitted to CRIS on 04/08/2003

Termination Report:
Nitrogen transformation rates in eight northeastern US research sites were measured in soil samples taken in the early season of 2000 and the late season of 2001. Net mineralization and nitrification rates were determined on Oa or A horizons samples by two different sampling methods: intact cores and repeated measurements on composite samples taken from around the cores. Net rates in the composite samples showed three different temporal patterns: high net nitrification with minimal ammonium accumulation, high net nitrification and high ammonium accumulation, and minimal net nitrification and moderate ammonium accumulation. The 4-week net rates in intact cores were about half that of the rates from the composite samples but were well correlated. Composite samples from sites that exhibited high net nitrification were incubated with acetylene and net nitrification was completely stopped, suggesting an autotrophic pathway. Gross mineralization and nitrification rates were estimated using the isotope dilution technique. Gross rates of nitrification and consumption in intact cores were relatively low. Gross rates of mineralization and net rates of nitrification were both correlated with the soil C/N ratio, with higher rates occurring in sites containing Acer as a dominant or co-dominant species. Accurate measurement of nitrification rates in disturbance-sensitive soils can be problematic. After disturbance by sampling, bulked Oa horizons showed rapid increases in nitrate concentration, with change detectable within 1 hour. Ammonium concentrations increased over the first 10 hours but decreased afterwards. Incubation with acetylene stopped nitrate accumulation but ammonium continued to increase. Intact cores also showed increases in nitrate after 1-3 days but at a much lower rate than bulked samples. Gross rates of nitrification in intact cores were much lower than net rates in bulk samples. The addition of ammonium to intact cores caused an increase in net nitrate after 20 h. These results suggest that sampling stimulates nitrification rapidly through an increase in ammonium availability. The ammonium increase may be due to a stimulation of ammonification caused by mixing, a decrease in spatial heterogeneity, or a disturbance in other types of ammonium consumption. The isotopic ratios of 18O/16O in soil nitrate were low at all sites and consistent with microbially-produced nitrate. The diversity of ammonia oxidizing bacteria at each site continues to be assessed.

Publications:
Ross,D.S. and H.C. Hales. 2003. Sampling-induced increases in net nitrification in the Brush Brook (Vermont) watershed. Soil Sci. Soc. Am. J. 67, 318-326.

Impact:
The comparison of methods suggests that all provide a similar hierarchy of potential rates but that the degree of net nitrification is strongly influenced by the degree of sample disturbance. In soils that exhibit high disturbance effects, nitrification rate measurements will not be accurate but still may represent the potential for nitrification with increased ammonium supply. Differences between sites appear to be related to an interaction of soil (C/N) and vegetation (Maple contribution) characteristics. This study has shown the importance of methodology in assessing soil nitrogen transformation rates. Using consistent methodology across sites, we have shown that an interaction of soil and vegetation effects may control nitrification rates. Work is continuing to explore the link between watershed nitrification rates and the stream export of nitrogen.

Multidisciplinary Evaluation of a Biopesticide Alternative to Facilitate Adoption

Investigators: Berkett, L. P., Garcia, M. E.

Performing Department: Plant & Soil Science -- 1825

Start Date: 09/15/2001 Termination Date: 09/14/2004
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
During the 2002 growing season data were collected on fruit weight, size, skin color, flesh firmness, soluble solids, starch index ratings, russetting, water core, internal breakdown or browning, bitter pit and other harvest disorders as well as overall fruit attractiveness using standard criteria. As measurements of tree productivity, data were collected on flower density, fruit set, and yield efficiency. In addition, incidence of disease and insect damage on fruit and foliage, along with incidence of bird damage, were recorded for the various treatments that compared kaolin to a standard pest management program. Currently, the very large volume of data are being summarized and analyzed. Growers are interested in this research and are being kept up-to-date on the project's progress (Obj. 3). A project description with its research objectives were part of a feature article in the Vermont Apple Newsletter whose subscribers include commercial apple growers, pest management consultants, and agricultural industry personnel, and the article was posted on the University of Vermont Apple Extension and Research Program website, UVM Apple Orchard (http://orchard.uvm.edu), which is accessed by apple growers across the country and around the world. A local television news program reported on the research. In addition, presentations were made at the 2002 Vermont Tree Fruit Growers Association Annual Conference (attended by approximately 150 growers and ag-industry personnel), the 2002 New England, New York, Canadian Fruit Pest Management Workshop (attended by 55 apple extension, researchers, and IPM consultants), and research progress will be presented at the 2003 New England Fruit School which is the major conference for the apple industry in the region.

Publications:
Garcia, M., Berkett, L., and T. Bradshaw. 2002. First year results of the impact of a novel pest management technology on apple fruit quality. XXVI International Horticultural Congress. Toronto, Canada. Proceedings: 277.

Impact:
Research will identify opportunities and/or constraints to grower adoption of the new 'reduced-risk' biopesticide and determine its optimal role in mitigating pest management challenges resulting from the implementation of the FQPA.

Novel Cultural Controls for Thrips in Spring Bedding Plants

Investigators: Skinner, M., Brownbridge, M., Parker, B. L.

Performing Department: Plant & Soil Science -- 1825

Start Date: 09/01/2001 Termination Date: 08/31/2004
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
Western flower thrips (WFT) are the primary pests of spring bedding plants in the Northeast. Direct feeding damage and their ability to vector plant viruses means that there are low tolerance thresholds on economically-important, sensitive crops such as impatiens. There are few effective controls available to growers and thrips rapidly develop insecticide resistance. To prolong the active lifetime of current pesticides, and to reduce the threat of early-season infestations, new cultural controls are badly needed. Many greenhouses in northern New England are allowed to stand empty over the winter; we do not know if thrips can survive in these fallowed houses and serve as a source of infestation for new plant material brought in to the houses in spring. Some growers heat empty greenhouses to force overwintering thrips to emerge, but the efficacy of this technique has not been documented, and the cost-benefit of this approach has not been determined. To find out whether WFT overwinter in northern New England, we monitored for thrips in 13 winter-fallowed production houses located in ME, NH and VT from December through May. Greenhouses were located in plant-hardiness zones 3, 4 and 5 and had either dirt/gravel floors, or floors covered with weed cloth (landscape fabric). Thrips were monitored using yellow sticky cards and emergence traps; weed samples were also collected every month and tested for virus (INSV and TSWV), and thrips. Using dataloggers, temperatures in- and outside greenhouses were recorded 50 and 5 cm above, 0 and 5 cm below ground. Soil data will be correlated with ambient temperature in/outside greenhouses and related to thrips cold-tolerance which is being established in parallel lab studies. Thrips were recovered from weeds or cards in 9 of the test greenhouses in January/February; 8 out of the 9 houses had gravel/dirt floors. INSV was recovered from weeds collected in 3 greenhouses; INSV was recovered from bedding plants grown in one of these houses in the spring. INSV was detected in seed and vegetative impatiens sampled in 2 other greenhouses during the spring. In January 2003, IPM workshops were given in ME, NH and VT, and included sessions on biocontrols for insect pests and diseases, new spray technology and other IPM-related topics. Over 120 growers attended the meetings. Thrips and virus monitoring will be repeated at additional sites during winter 2002/2003. The sensitivity of sticky cards and indicator plants for detecting early season thrips populations and tospovirus will be evaluated, and the utility of the methods for small-medium sized businesses assessed.

Publications:
(No publications.)

Impact:
From this research we will know whether thrips can survive the winter in/outdoors in northern New England, and will know what level of risk they pose to incoming crops. We will be able to develop a predictive survival model for each plant hardiness zone and floor type, and will be able to recommend techniques to detect low numbers of WFT to facilitate use of reduced-risk pesticides and biocontrols. Recommendations on sound cultural control methods will be devised from our results and transferred to growers; the findings will be immediately applicable to >5000 growers in the Tri-state region and many more in 31 states having similar plant-hardiness zones.

Western Flower Thrips Coldhardiness and its Relationship to Greenhouse IPM

Investigators: Skinner, M., Parker, B. L., Brownbridge, M.

Performing Department: Plant & Soil Science -- 1825

Start Date: 10/01/2000 Termination Date: 09/30/2003
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
Western flower thrips (WFT) are the primary pests of spring bedding plants in the Northeast. Their ability to vector important plant viruses means that there are low tolerance thresholds on economically-important, sensitive crops such as impatiens. Thrips have become resistant to most major classes of insecticide and there are few effective controls presently available to growers. To prevent excessive use of these materials and to prolong their usefulness, new cultural controls are badly needed. Many greenhouses in northern New England are allowed to stand empty over the winter; we do not know if thrips, and the plant viruses associated with them, can survive in these fallowed houses and serve as a source of infestation and infection for new plant material brought in to the houses in spring. To answer this question, 13 winter-fallowed production houses located in ME, NH and VT were monitored for WFT from December through May. Greenhouses were located in plant-hardiness zones 3, 4 and 5 and had either dirt/gravel floors, or floors covered with weed cloth (landscape fabric). Thrips were monitored using yellow sticky cards and emergence traps; weed samples were also collected every month and tested for virus (INSV and TSWV), and thrips. Thrips were recovered from weeds or cards in 9 of the test greenhouses in January/February; 8 out of the 9 houses had gravel/dirt floors. INSV was recovered from weeds collected in 3 greenhouses; INSV was recovered from bedding plants grown in one of these houses in the spring. INSV was detected in seed and vegetative impatiens sampled in 2 other greenhouses during the spring. Temperatures in- and outside greenhouses has been recorded 50 and 5 cm above, 0 and 5 cm below ground to document temperatures that thrips would, potentially, be exposed to in/outside greenhouses. In parallel lab studies we are continuing to investigate WFT tolerance to low temperatures. We have shown that survival of 2nd instar, propupae and adult female WFT drops from 100% at -10 C to 0% at -17.5 C, depending on the time of exposure; increasing the time of exposure from 2 to 8 h increased mortality at all test temperatures. No thrips survived exposure to -20 C. Trials to evaluate effects of cold-exposure on longevity and fecundity of female WFT are nearing completion but data indicate that exposure to sub-lethal temperatures substantially reduces longevity and fecundity. In January 2002, IPM workshops were given in ME, NH and VT, and included sessions on biocontrols for insect pests and diseases, new spray technology and other IPM-related topics. Over 120 growers attended the meetings. Thrips and virus monitoring will be repeated at additional sites during winter 2002/2003.

Publications:
(No publications.)

Impact:
From this research we will know whether thrips can survive the winter in/outdoors in northern New England, and will know what level of risk they pose to incoming crops. Appropriate cultural practices to reduce/eliminate this risk can then be tested and their economic viability determined prior to recommending their implementation. We will be able to develop a predictive survival model for each plant hardiness zone and floor type. Recommendations on sound cultural control methods will be devised from our results and transferred to growers; the findings will be immediately applicable to >5000 growers in the Tri-state region and many more in 31 states having similar plant-hardiness zones.

Genetic and Physiological Characterization of a Novel Iron-Regulated Bacterial Pollutant Degradation Activity

Investigators: Lewis, T.

Performing Department: Molecular Genetics and Microbiology -- 2162

Start Date: 10/01/2001 Termination Date: 09/30/2004
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
The transition metal chelator and dechlorination agent pyridine-2,6-dithiocarboxylic acid (PDTC), has been presumed to act as a siderophore, binding ferric iron with high affinity and allowing receptor-mediated uptake of the formed complex by certain soil and plant-colonizing bacteria. To further test this hypothesis and one including a role in uptake of other transition metals, we have examined production of PDTC, production of the known siderophore pyoverdine (pvd), and effects of mutations involving each of those excreted products to learn more about their potential physiological roles under various metal deprivation and supplementation regimes. PDTC production was negatively affected by addition of nickel or zinc at concentrations that did not significantly reduce pvd production. A series of mutants of Pseudomonas putida DSM 3601 defective in production of pvd and/or PDTC were constructed and characterized to compare the respective functions, and to observe any compensatory changes resulting from the mutations. Pvd-negative mutants were more sensitive than the wild-type strain to the ferric iron chelator EDDHA whereas a mutant defective only in PDTC production was not. PDTC-negative and pvd-negative mutants were more sensitive than wild-type to the divalent transition metal chelator 1, 10-phenanthroline (o-p). With the addition of PDTC mutants were indistinguishable from wild type strains in the minimum inhibitory concentration of o-p. Coordinate regulation of PDTC and pvd was indicated by data showing an increase in PDTC production in certain pvd-negative mutants, and decreases in PDTC production by the wild-type strain in response to added pvd. Outer membrane profiles of PDTC-producing Pseudomonas strains were also examined to identify potential receptors. An iron-regulated outer membrane protein (IROMP) of approximately 66 kilodaltons was present in PDTC-producing but not non-producing Pseudomonas strains. The same 66 kDa IROMP was expressed by mutants that were defective in PDTC production only when PDTC was added to the culture medium. Together these data indicate a role for PDTC in the uptake of transition metals other than ferric iron.

Publications:
(No publications.)

Impact:
Factors limiting dechlorination of certain pollutants have been identified, as well as new genetic tools for the study of the physiology of a novel dechlorination agent.

Improve the effectiveness of CRIS to CSREES institutions through enhanced microcomputer processes.

Investigators: Downer, P. S., Lang, S. J., Iron, J. R., Welch, K. A.

Performing Department: Communication and Technology Resources -- 5068

Start Date: 07/15/1999 Termination Date: 07/14/2003
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
Enhancements implemented in 2002 include: 1) users can link directly to the CRIS record for any project on the AD-421 fill-in form and the Administrative function to display/edit project list; 2) a new feature allows AD-419s to be selected by GPRA goal and the AD-419 table displays the percent assigned in each goal; 3) there is now just one access point for all administrative functions (site and password are only entered once); 5) a status screen displays useful site statistics such as the number of AD-416 or AD-421 forms in progress or ready to be submitted and also displays any pending or deferred projects; 6) deferred projects can now be resubmitted using the web forms. Also added were the ability for sites to include a message to site users at the time they select their site and new user types Financial Manager and Data Manager. Another user type, Department Representative, is being designed, along with the ability to submit additional CSREES-2008 assurance forms for one project, a new relational CRIS data structure export option, and ability to select projects for one investigator even if the investigator is not the PI. Prototypes for SERD and other USDA agencies to submit project descriptions and reports to CRIS have been developed and are pending review. User support, web server maintenance, upgrades and security procedures are ongoing.

Publications:
(No publications.)

Impact:
Enhancements to the CRIS Web forms programs improve the quality of information in the CRIS database and make the processes easier for contributing sites. These enhancements also make processing tasks at CRIS more efficient and expand the ability to provide current information to contributing sites and all other users of this database.

BALANCING ECONOMIC AND ENVIRONMENTAL IMPACTS OF PHOSPHORUS MANAGEMENT

Investigators: Parsons, R., Jokela, W., Meals, D., Budd, L., Wood, L.

Performing Department: Community Development and Applied Economics -- 6089

Start Date: 02/15/1998 Termination Date: 02/28/2002
Reporting period: 02/15/1998 to 02/28/2002
Report was submitted to CRIS on 04/08/2003

Termination Report:
Agricultural production and manure management practices have been closely associated with the problem of phosphorus (P) contamination of surface and ground water. This project's overall goal was to evaluate the potential economic and environmental trade-offs of different phosphorus management practices on Vermont dairy farms. Ten different field and animal practices were examined including manure storage, waste water control, reducing feed phosphorus content, controlling water runoff, balancing nutrient needs, field buffers, streambank buffers, strip farming, and manure export. The project used a farm level income simulation model, FLIPSim, in combination with a watershed nutrient flow environmental model, GISPLM to provide estimated corresponding farm financial and environmental impacts of the selected Best Management Practices (BMP). The study examined the impacts on three different size Vermont dairy farms (60, 150, and 350 cows) . The financial impact examined farm profitability and change in the probability of farm survival with the implementation of the financial benefits and costs related to each BMP. The environmental impact examined the change in phosphorus runoff that would be deposited in Lake Champlain. The ultimate goal was to determine which or combination of BMPs would achieve an 8% reduction in phosphorus losses at the least farm level cost. The results indicate that feed reformulation and nutrient balancing are the least cost BMPs because they actually provide savings to the dairy farms. All other BMPS lowered farm profitability although did not significantly affect farm survivability. However, no one BMP achieved an 8% decrease in phosphorus losses. But we did find that a combination of 3 BMPs (feed reformulation, nutrient balancing, and streambank buffers can approach the 8% goal. Additional, less effective but more costly BMPs will have to be implemented to meet a 10% goal. Financially, none of the individual BMPs suggest that farms will be forced out of business. However, the initial declining financial position of the small farm is hastened by the implementation of all BMP's nutrient balancing and feed reformulation. The medium farm is also threatened financially by several costly BMPs. While the impacts are not enough to threaten survivability, they do affect the farms' ability to meet outside financial challenges such as lower milk prices or drought. The large farm is least threatened financially. However, the large farm provides challenges to policymakers because it has the greatest financial stake but also the concentration of more animals on one site increases the size of environmental damage that could occur as the result of a major accident.

Publications:
(No publications.)

Impact:
The results show policymakers and ag leaders that few BMPs present the opportunity of a win-win situation, where both the farm and environment benefit. The results indicate that achieving a greater than 8% decrease in phosphorus losses will require adopting farm level BMPs that will affect farm profitability.

Building quality community based long term care systems.

Investigators: Kolodinsky, J. M.

Performing Department: Community Development and Applied Economics -- 6089

Start Date: 10/01/1999 Termination Date: 09/30/2002
Reporting period: 10/01/1999 to 09/30/2002
Report was submitted to CRIS on 04/08/2003

Termination Report:
This project measured satisfaction and quality of care, measured by consumer outcomes, for disabled individuals in two States and to compare it.

Publications:
Lee, Jinkook, Kim, Hyoung-Soo, & Kolodinsky, Jane (2002) Chronic disease and wealth depletion of elderly women living in urban and rural areas. The Gerontologist, 42, special issue 1, 159.

Impact:
This project informed policy makers of the factors that influence, and care options that best allow consumers to live in the residential setting of their choice, given the market conditions in a particular geographic area: and tested unproven assertions found in the literature that more objective measures of satisfaction are better indicators of consumer views of quality of care than more subjective measures.

Census 2000 in Vermont, an economic and demographic trend analysis.

Investigators: Schmidt, F.

Performing Department: Community Development and Applied Economics -- 6089

Start Date: 10/01/1999 Termination Date: 09/30/2002
Reporting period: 10/01/1999 to 09/30/2002
Report was submitted to CRIS on 04/08/2003

Termination Report:
Funding for this project was substantially lower than we requested. The development of hard-copy publications was not feasible on so limited a budget. However, we did develop a Powerpoint presentation explaining basic Census geography, data available, and how to get information from the Census Bureau's, as well as our own web sites. We presented this at meetings of various groups, including our State Data Center Affiliate network (made up of Regional Planning Commissions, state agencies and local libraries) and municipal officials attending the 4 regional Municipal Officers Management Seminars in 2001. In 2002, we focused this presentation on community planners with a workshop on incorporating Census data into municipal plans and presented it at the 5 regional Town Officers Education Conferences. Other trainings included 4 hands-on events in which staff from the U.S. Census Boston Regional office came to Vermont to lead workshops on how to access Census data online. These workshops were attended by Vermont State Data Center Affiliates and other data users from the state agency and non-profit realms. Several publications and hand-outs have been created that are meant to inform the use of Census Data. The most prominent of these was 'Census 2000: Its Challenges to Policy in Vermont,'a monograph that has been used as the focus of presentations around the state. Another handout, 'The Role of Demographics in Municipal Planning,' provides a look at how Census data can be applied to community planning. Often Census data was explored at the community level. An example of this would be 'Shelburne Data Night,' during which residents of a growing Vermont town were shown various Census data trends for their community. In terms of online data resources, the 'Census 2000 Demographic Profiles' site (http://crs.uvm.edu/2000dps) was developed to allow easy access to the full four-page 2000 demographic profiles once they were released in May, 2002. This resource remains one of the most-accessed sites of all Center for Rural Studies web resources.

Publications:
Schmidt, F.E., & M.E. Murphy, eds. 2002. "Census 2000: Its Challenges to Policy in Vermont." The University of Vermont Center for Rural Studies: Burlington, VT.

Impact:
Vermont citizens, from the community level to the state level, were given opportunities to learn more about accessing and using U.S. Census data. Workshops and presentations were attended by more than 250 municipal officials, state agency officials, regional planners, non-profit staff, librarians, and more. The 'Census 2000 Demographic Profiles' site (http://crs.uvm.edu/2000dps) receives an average of 1,461 hits weekly. This project has resulted in the education of many and the creation of resources that will continue to educate many more.

Impact of electronic financial services technology: Adoption of innovation and consumer problems.

Investigators: Kolodinsky, J. M.

Performing Department: Community Development and Applied Economics -- 6089

Start Date: 10/01/1999 Termination Date: 09/30/2002
Reporting period: 10/01/1999 to 09/30/2002
Report was submitted to CRIS on 04/08/2003

Termination Report:
The objectives of this research were to identify who are the current users and non-users of electoronic financial services. 2. Identify who are more or less likely adopters of electronic financial services. 3. Identify what kinds of problems do consumers face when utilizing electronic financial services. 4. Identify problems and complaints of dissatisfied consumers.

Publications:
Hogarth, Jeanne, Jane Kolodinsky, and MaryAnne Hilgarth, (2002), Voting with Your Feet: Consumers' Problems with Credit Cards and Exit Behaviors, American Council on Consumer Interests. Winner, Best Applied Consumer Economics Award, available: http://www.consumerinterests.org/membersonly/articles/index.html?cat=244.

Hogarth, J., M. Hilgert, and J. Kolodinsky, (2002, in press), Consumers' Problems with Credit Cards and their Exit Behaviors, Journal of Services Marketing.

Impact:
The result of this project identified factors associated with consumer dissatisfaction and complaints with electronic financial services. Exit (changing financial institution) was associated with marital status, race, how dissatisfied the consumer was and whether the consumer took a private complaining action. Consumers who were likely to resolve their problem were only twenty percent as likely to exit.

Symbolic Attributes: Differentiating Rural Towns from Planned Shopping Centers

Investigators: Sullivan, P., Trent, E. S.

Performing Department: Community Development and Applied Economics -- 6089

Start Date: 10/01/2000 Termination Date: 12/31/2002
Reporting period: 10/01/2000 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Termination Report:
Preliminary data, examining if and how symbolic and performative attributes can be used to differentiate town center apparel shopping areas and planned shopping centers, is presented. The survey instrument was developed based on the review of literature and results of focus group sessions from a preliminary UK study that provides the grounding for this study. The constructs symbolic attributes and performative attributes were measured using scaled statements. The survey was modified to reflect English spoken in the U.S. and local shopping destinations, pretested and revised accordingly. Data were collected using a mall intercept technique in one rural town center. The survey included Likert scale statements about symbolic and performative attributes and requested demographic information. The sample for this analysis included 34 people who lived in the rural community and 23 who did not. Respondents' ranking of the importance symbolic and performative attributes when shopping for apparel in a rural town center were: 1.) services provided, 2.) street-layout and ambience, 3.) value for money, 4.) retailer efforts to help people in need, and 5.) parking facilities and access. When not apparel shopping in this town center, respondents' most referred shopping destination was another town center. Only 3.5% of respondents preferred a shopping mall instead of a town center. Only 1.8% preferred a discount store or internet for apparel shopping. Respondents' ranking of the importance symbolic and performative attributes when shopping for apparel out-of-town were: 1.) services provided, 2.) exclusive and service oriented stores 3.) parking facilities and access, 4.) value for money, and 5.) street-layout and ambience. It is interesting to note that the out-of-town shopping destination was rated higher for both the quality of the shopping environment and support for the local community and environment. Findings from this study should be viewed with caution because they are preliminary and the number of respondents is low. More data is currently being analyzed to add to the generalizability of the results.

Publications:
Sullivan, P., Alexander, A., Oppewal, H. (2002). Town centers: Experiential learning opportunities for retail education. European Association of Education and Research in Commercial Distribution (EAERCD) 7th Teaching Conference Proceedings, Cheltenham, UK, July 10-12, 2002, 160-169.

Sullivan, P., Alexander, A., Oppewal, H. (2002). The influence of symbolic and performative attributes on consideration of rural apparel shopping destinations. ITAA Proceedings, International Textile and Apparel Association Annual Meeting, New York, NY, August 6-10, 2002

Cui, Yanli. (2002). "Cause-related marketing from the consumer perspective." Department of Community Development and Applied Economics, The University of Vermont.

Impact:
One out of the top five criteria in evaluating the local town center for apparel shopping was a symbolic attribute. Thus symbolic attributes contribute to the marketing mix for rural retailers when targeting local customers. Preliminary results indicate that town centers are preferred locations for rural consumers when shopping for apparel. Communities can use this information to enhance comparative advantage and location differention. Information already has been used by one rural community in examining how to add to their town's centers vitaliity.

Organic Food Industry and It's Potentials for Improving Farm Profitability and Food Safety

Investigators: Wang, Q.

Performing Department: Community Development and Applied Economics -- 6089

Start Date: 10/01/2000 Termination Date: 09/30/2003
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
The overall goal of this proposed project is to assess the potentials of Vermont's organic food industry and to provide economic and marketing information that can help the industry expand its market and improve its efficiency and profitability. A conjoint survey was developed and conducted in Vermont in 2002 to collect primary data for the study. Our analysis of data from 529 respondents suggests four major conclusions. First, 56.9% of the respondents purchased organic food in 2001 and their average expenditure on organic food was $72.7 per month. These numbers indicate that there is a significant market for organic food in Vermont. Second, results from conjoint analysis show that location and price were considered as the two most important attributes for Vermont consumers. Location contributed to the largest percentage (31.7%) of the preference rating for the respondents who purchased organic food, while price contributed to the largest percentage (49.3%) for the respondents who did not purchase organic food. In other words, location (produced in Vermont or not) was an important factor to the organic food buyers while price was crucially important to consumers who have not purchased organic food. These results represent an encouraging message to the organic farmers and retailers who are located in Vermont. It basically implies that they can charge a price premium for organic food without significantly decreasing their sales. Third, the results from the regression model with demographic variables indicate that young people with high income, smaller household size and fewer children were willing to pay more for organic food. People living in the Northeastern Kingdom (rural area in Vermont) are willing to pay more for organic food than people living in Chittenden County (urban area of Vermont). Fourth, the results from our logit model analysis suggest that female young people with smaller household size, living in Northeastern Kingdom in Vermont, having higher education level, and married were more likely to purchase organic food.

Publications:
Sun, J. and Wang, Q. 2002. A conjoint analysis of consumer demand for organic apples in Vermont. Agricultural and Resource Economics Review. 31/2: 263.

Sun, J. 2002. Consumer demand for organic food in Vermont. MS thesis, University of Vermont.

Impact:
Our survey and conjoint analysis provide information on the relative importance of product attributes, willingness to pay for organic food, and the characteristics of organic food consumers and such information is useful to organic farmers and retailers.

Appraising the Use of Technology and Production Practices on Vermont Dairy Farms

Investigators: Parsons, R. L.

Performing Department: Community Development and Applied Economics -- 6089

Start Date: 10/01/2001 Termination Date: 09/30/2003
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
A mail survey of 1455 Vermont dairy farmers was conducted in spring of 2002. The survey generated a response from 873 dairy farmers for a return rate of 60%. Farmers were asked questions on farm production technology, production practices, production units, operator characteristics, operator concerns, and satisfaction. The survey found that the average Vermont dairy farm consisted of 115 cows producing 17,300 pounds of milk. The average operator is age 49. However the average distorts the view of the state's dairy industry as the median herd size is only 70 cows with median milk production of 19,000 pounds of milk per cow. The survey also offered information on the use of farm labor. More than 30% of Vermont dairy farmers employ at least one non-family worker on a full time basis. Common benefits for these workers include a mixture of housing, bonuses, vacation, and IRA plans. The data is still currently being analyzed for further key information. The full report of the project will provide UVM Extension an updated picture of the current state of the Vermont dairy industry.

Publications:
(No publications.)

Impact:
The initial frequencies have provided information to UVM Extsnsion, USDA agencies, and the Vermont Dept. of Agriculture, Food, and Markets knowledge on the current status of the Vermont dairy industry.

Estimating/Forecasting Tourism Demand in Vermont Using Integrated Econometric Models

Investigators: Liang, C.

Performing Department: Community Development and Applied Economics -- 6089

Start Date: 10/01/2001 Termination Date: 09/30/2004
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
Tourism is a major source of revenue and employment for the Vermont economy. Local businesses and policy makers are constantly seeking information for marketing strategies associated with economic development issues. One of the key concepts is to understand tourists' profile as well as to estimate tourism demand. This study uses a national tourist survey targeting on domestic pleasure travelers and is designed to (1) examine tourists' profile such as origin, destination, household composition, information access and communication, social and personal characteristics, and willingness to visits; (2) estimate tourists' expenditures in tourism industry such as lodging, eating and drinking, recreation, transportation, and retail; (3) estimate demand elasticities related to expenditure, number of trips, and income using econometric models; and (4) develop a framework to forecast tourism demand for Vermont. The tourism industry is highly competitive and is marked by intense rivalry for the tourist's discretionary income between regions. To understand tourists' profiles, activities, and expenditures become extremely important to Vermont policy makers as well as Vermont entrepreneurs. Such information will (1) help policy makers implement appropriate marketing strategies to promote Vermont tourism industry and Vermont products; (2) improve the knowledge to enhance local entrepreneurial activities which fill the needs of the tourists; and (3) provide a database for future studies on economic development associated with tourism industry and other industries in Vermont. By forecasting tourism demand, this proposed research will (1) identify key economic variables which will significantly influence the number of trips that tourists are willing to make to visit Vermont; (2) improve the knowledge for decision makers to implement appropriate marketing strategies to enhance economic and business opportunities for Vermonters related to the tourism industry; and (3) provide an analytical framework for policy makers as well as entrepreneurs to modify business strategies to improve the economic benefits which could further improve the quality of life for Vermonters.

Publications:
(No publications.)

Impact:
The study will provide a framework to estimate variables influencing tourism demand, to estimate the elasticities for each variable relating to the number of visits, as well as to forecast the number of visits. The results will assist economic development groups to understand the structure of tourism industry in Vermont, as well as to modify marketing and promotions plans for Vermont businesses and products. Business owners and general public will also benefit from the findings in terms of creating a feasible strategy to interact with tourism development issues.

Socioeconomic change in Vermont

Investigators: Schmidt, F. E.

Performing Department: Community Development and Applied Economics -- 6089

Start Date: 10/01/2002 Termination Date: 09/30/2005
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
A study of changes in Vermont community populations and size categories over the past 40 years has been performed. Socio-economic data updates to Vermont Indicators Online (http://crs.uvm.edu/indicators) have been completed. At the community level, socio-economic trends in Shelburne, Vermont, have been explored in a series of newspaper articles. The monograph, 'Census 2000: Its Challenges to Policy in Vermont,' has been presented and video-recorded on many different occasions.

Publications:
(No publications.)

Impact:
Already, this project has produced many resources that planners, policy-makers, and citizens can use to understand socio-economic changes in Vermont.

Distribution, Innovation and Outreach in Information Technologies for Vermont Data Users

Investigators: Schmidt, F. E.

Performing Department: Community Development and Applied Economics -- 6089

Start Date: 07/01/2001 Termination Date: 06/30/2003
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
The three projects within this grant have led to the development of outreach and technology resources to assist communities and citizens in using data to support decision-making processes, and in implementing innovative new ways to provide municipal government information and services. The objective of the E-Government Outreach Project (http://crs.uvm.edu/egov) is to support the use of information technology in municipal offices for the development of new and innovative ways of disseminating services and information and conducting municipal business electronically. The Electronic Records Management Working Group (http://crs.uvm.edu/municipal/erm) has been created to produce reports and workshops for municipal officials on dealing with the I.T. issues surrounding proper use of e-government. At this point, more than 81 municipal official contacts have been made in workshops on computer and data safety and database planning. More are planned for April, 2003. The objective of the Community Planning Demonstration Project (http://crs.uvm.edu/cpdp) is to develop data tools that will support community planning activities in Vermont. This project has focused on the development and enhancement of tools to assist municipal land use officials in the data collection and analysis aspects of their duties. Examples of these tools include the online Town Plan Guide (http://crs.uvm.edu/cpdp/planner) and the computer-based Community Build-Out Analysis Software (http://crs.uvm.edu/cpdp/buildout). Work with the Lamoille County Planning Commission has helped to evaluate these tools from the perspective of 3 Vermont municipal planning commissions. Workshops on incorporating data into municipal plans have been attended by 57 members of Vermont's planning community. The Indicators for Vermont Communities Project addresses the provision of social and economic data for the purposes of community and small business development and to address the needs of Vermont decision-makers. The centerpiece of this project is the Vermont Indicators Online (http://crs.uvm.edu/indicators) website, enhancements to which have included the provision of data for Vermont villages. This project also helps support the Center for Rural Studies' (CRS) activities as the Vermont State Data Center for U.S. Census Bureau information, including Census data access workshops in January, 2003, attended by 42 staff members from state agencies, regional planning commissions, libraries, and nonprofit organizations. This project also produced several qualitative community profiles from online sources, demonstrating the use of information technologies in community and economic development. In addition, an exploration of Vermont housing data needs was performed. The result is a collaborative housing data website between CRS and the Vermont Housing Finance Agency, set for debut on April 1, 2003. CRS also performs approximately 60 data requests a month via email or phone.

Publications:
(No publications.)

Impact:
This grant will continue and expand upon the I.T. training and outreach and the development of data resources that began with earlier USDA funds. This grant, through more than 270 contacts with municipal officials and members of the planning community and the creation and enhancement of online data resources, will show Vermonters how they can utilize information technology to span geographic distances throughout the state and enrich community decision-making processes. Municipal data and processes are what make Vermont's government operate effectively, and the work of this grant will continue to show resource-strapped municipal officials and planners new ways to properly provide this information to the state's residents. Thus, once again, USDA resources will be used to set the stage to further the use and provision of E-Government and I.T. for decision-making in Vermont.

Technology and Data Training and Outreach in Rural Vermont

Investigators: Schmidt, F. E.

Performing Department: Community Development and Applied Economics -- 6089

Start Date: 07/01/2002 Termination Date: 06/30/2005
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
The three projects within this grant will contribute to the development of outreach and technology resources to assist communities and citizens in using data to support decision-making processes, and in implementing innovative new ways to provide municipal government information and services. The objective of the Municipal E-Government Outreach Project (http://crs.uvm.edu/egov) is to support the use of information technology in municipal offices for the development of new and innovative ways of disseminating services and information and conducting municipal business electronically. Plans are underway to convene a Municipal E-Government Conference in 2004. This will be a collaborative effort with the Vermont League of Cities and Towns and other interested organizations. The primary theme of the conference will be the creation of management of municipal websites. The proper management of electronic records and information will also be a major theme. The conference will consist of hands-on workshops as well as discussion sessions. The objective of the Community Planning Tools Project (http://crs.uvm.edu/cpdp) is to develop data tools that will support community planning activities in Vermont. This project has focused on the development and enhancement of tools to assist municipal land use officials in the data collection and analysis aspects of their duties. Enhancements to the Town Plan Guide (http://crs.uvm.edu/cpdp/planner) will include integration with the Vermont Planning Info-Center (VPIC) website. Planning and development for the VPIC is currently underway through collaboration with the VT Municipal Land Use Curriculum Collaborative. Work has also begun on enhancements to the Community Build-Out Analysis Software (http://crs.uvm.edu/cpdp/buildout) to incorporate more commercial development factors into the tool's analyses. The Indicators for Vermont Communities Project addresses the provision of social and economic data for the purposes of community and small business development and to address the needs of Vermont decision-makers. The centerpiece of this project is the Vermont Indicators Online (http://crs.uvm.edu/indicators) website. This project is also helping to support the Center for Rural Studies' (CRS) activities as the Vermont State Data Center for U.S. Census Bureau information. CRS also performs approximately 60 data requests a month via email or phone.

Publications:
(No publications.)

Impact:
This grant will continue and expand upon the I.T. training and outreach and the development of data resources that began with earlier USDA funds. This grant, through the planned E-Government Conference and the creation and enhancement of online data resources, will make contact with more than 250 municipal officials and show all Vermonters how they can utilize information technology to span geographic distances throughout the state and enrich community decision-making processes. Municipal data and processes are what make Vermont's government operate effectively, and the work of this grant will continue to show resource-strapped municipal officials and planners new ways to properly provide this information to the state's residents. Thus, once again, USDA resources will be used to set the stage to further the use and provision of E-Government and I.T. for decision-making in Vermont.

Strengthening and Expanding Community Development through Farmer's Markets

Investigators: Kolodinsky, J., Peabody, M., Rowe, E.

Performing Department: Community Development and Applied Economics -- 6089

Start Date: 10/01/2002 Termination Date: 09/30/2004
Reporting period: 01/01/2002 to 12/31/2002
Report was submitted to CRIS on 04/08/2003

Progress Report:
The farmer's market of Alburg has been up and running for two years. Weekly receipts per vendor average $200-$300, indicating sales are strong. Marketing workshops are currently taking place during the winter months to help vendors develop strategies to increase market traffic and increase the number of vendors at the site.

Publications:
(No publications.)

Impact:
We expect that development of a viable farmer's market will increase the income of vendors and contribute to a vibrant local community.