The genetic code refers to how the gene sequence in translated into protein sequence. Three consecutive nucleotides encode for one amino acid. The three nucleotides are referred to as a codon. Each codon represents a single amino acid, though some amino acids have several different codons. There are 20 different amino acids in human proteins so some amino acids are encoded for by more than one codon (this is refered to redundancy of the genetic code).
To make a protein correctly, the ribosome needs to know where to start and end translation. In humans one codon, ATG, signals for translation to begin. This start codon establishes the reading frame, or how the nucleotide triplets will be grouped. The figure on the right shows how a genetic sequence could be translated three different ways depending on where you decided to start. Once translation begins, a protein is made by sequential addition of amino acids into a chain. This continues until a "stop codon" is reached which signals for protein synthesis to end. The human genetic code has three stop codons: TAA, TAG and TGA.	Potential reading frames for a given sequence.
	The genetic code shows how the genetic code is translated into amino acids. The three nucleotide codons (left margin of each column) are shown with their corresponding amino acid. For instance, the codon TTT encodes for the amino acid Phenylalanine (Phe).

           The following example takes you through the steps of translating the genetic code to find the protein sequence.

You have the gene sequence and want to know the protein sequence.	TCCGATGTTTTCGTGTTGACGA
First identify the start codon to determine the reading frame.	TCCGATGTTTTCGTGTTGACGA
Use the genetic code above to translate the code into amino acids.	TCCG ATG TTT TCG TGT TGA CGA      Met Phe Ser Cys Stop
You now know the protein sequence!	Met-Phe-Ser-Cys